(Notice): Undefined variable: solution_of_interest [APP/View/Products/view.ctp, line 747]Code Context $errorType = self::getErrorType($code);
self::logToDatabase( $errorType, $description, $file, $line);
return parent::handleError( $errorType, $description, $file, $line, $context);
$viewFile = '/var/www/dev.diagenode.com/app/View/Products/view.ctp'
$dataForView = array(
'language' => 'en',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'product' => array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
[maximum depth reached]
),
'Master' => array(
[maximum depth reached]
),
'Product' => array(
[maximum depth reached]
)
),
'Related' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
)
),
'Document' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
),
(int) 6 => array(
[maximum depth reached]
),
(int) 7 => array(
[maximum depth reached]
),
(int) 8 => array(
[maximum depth reached]
),
(int) 9 => array(
[maximum depth reached]
),
(int) 10 => array(
[maximum depth reached]
),
(int) 11 => array(
[maximum depth reached]
),
(int) 12 => array(
[maximum depth reached]
),
(int) 13 => array(
[maximum depth reached]
),
(int) 14 => array(
[maximum depth reached]
),
(int) 15 => array(
[maximum depth reached]
),
(int) 16 => array(
[maximum depth reached]
),
(int) 17 => array(
[maximum depth reached]
),
(int) 18 => array(
[maximum depth reached]
),
(int) 19 => array(
[maximum depth reached]
),
(int) 20 => array(
[maximum depth reached]
),
(int) 21 => array(
[maximum depth reached]
),
(int) 22 => array(
[maximum depth reached]
),
(int) 23 => array(
[maximum depth reached]
),
(int) 24 => array(
[maximum depth reached]
),
(int) 25 => array(
[maximum depth reached]
),
(int) 26 => array(
[maximum depth reached]
),
(int) 27 => array(
[maximum depth reached]
),
(int) 28 => array(
[maximum depth reached]
),
(int) 29 => array(
[maximum depth reached]
),
(int) 30 => array(
[maximum depth reached]
),
(int) 31 => array(
[maximum depth reached]
),
(int) 32 => array(
[maximum depth reached]
),
(int) 33 => array(
[maximum depth reached]
),
(int) 34 => array(
[maximum depth reached]
),
(int) 35 => array(
[maximum depth reached]
),
(int) 36 => array(
[maximum depth reached]
)
),
'Testimonial' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Area' => array(),
'SafetySheet' => array()
),
'meta_canonical' => 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul',
'fromEmail' => 'dev.diagenode.com'
)
$language = 'en'
$meta_keywords = ''
$meta_description = 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. '
$meta_title = 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode'
$product = array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
'id' => '368',
'name' => 'C01070013',
'product_id' => '3246',
'modified' => '2025-05-28 18:57:02',
'created' => '2025-05-27 23:47:46'
),
'Master' => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
'Product' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
)
)
),
'Related' => array(
(int) 0 => array(
'id' => '3158',
'antibody_id' => null,
'name' => '24 UDI for Tagmented libraries - Set I',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries – Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011034',
'old_catalog_number' => '',
'sf_code' => 'C01011034-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2024-05-15 10:25:12',
'created' => '2020-12-08 15:26:23',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '3185',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set II',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> <strong>24 UDI for tagmented libraries - Set II</strong><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<div id="info1" class="content active">
<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011036',
'old_catalog_number' => '',
'sf_code' => 'C01011036-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set2',
'meta_title' => '24 unique dual indexes for tagmented libraries set 2',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-01-09 19:07:24',
'created' => '2021-02-25 11:36:33',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '3206',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set III',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries </strong>includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation</a><a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns"> for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation</a><a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones"> Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2" target="_blank">24 UDI for tagmented libraries - Set II</a><br /> 24 UDI for tagmented libraries - Set III</p>
<p><br />Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries sets </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011037',
'old_catalog_number' => '',
'sf_code' => 'C01011037-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set3',
'meta_title' => '',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-04-06 12:02:03',
'created' => '2021-10-21 15:29:18',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 3 => array(
'id' => '3184',
'antibody_id' => null,
'name' => 'ChIPmentation Kit for Histones',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/chipmentation-for-histones-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ChIPmentation</b> is a method that combines <b>chromatin </b><b>immunoprecipiation</b> and <b>tagmentation</b><b>-based library preparation </b>using a fast and robust ChIP-seq protocol for studying <b>protein/DNA interactions</b>. In this method, following chromatin immunoprecipitation, the sequencing libraries are created directly on the chromatin-antibody-beads complex by the Tagmentase (Tn5 transposase) loaded with sequencing adapters. </p>
<p>The <b>ChIPmentation</b><b> Kit for Histones </b>includes all reagents for chromatin preparation, chromatin immunoprecipitation and library preparation using tagmentation. The <b>primer indexes </b>for multiplexing are <b>not included</b> in the kit and have to be purchase separately:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for </a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"> libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for </a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a> <a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for </a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"> libraries Cat. No. C01011032</a></li>
</ul>
<p><b>Benefits of the </b><b>ChIPmentation</b><b> system for histone </b><b>ChIP</b><b>-seq</b></p>
<ul>
<li>Easier and faster than classical ChIP-seq</li>
<li>Validated for various histone marks for a standard amount of cells</li>
<li>Generate high quality sequencing data</li>
</ul>
<p>For low input samples (10,000 cells) we recommend the <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">µChIPmentation kit for Histones</a>.</p>
<p>For ChIP-seq on transcription factors we recommend the <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">iDeal</a> <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">ChIP-seq</a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns"> for transcription </a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">factors</a> + <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a></p>',
'label1' => 'Validation',
'info1' => '<p>The Diagenode ChIPmentation technology has been tested on histone marks and compared to available datasets from the ENCODE project (Figure 1). ChIPmentation generated high quality data with low background. In addition, more than 99% of the top 40% peaks obtained with auto-ChIPmentation overlap with ENCODE datasets, which shows that ChIP-seq data obtained with ChIPmentation are highly reliable.</p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-1.png" /></p>
<div class="row">
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-2.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-3.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-4.png" /></div>
</div>
<p><small><b>Figure 1: </b><b>ChIPmentation</b> <b>sequencing</b> <b>results</b> <b>obtained</b> <b>from</b> <b>decreasing</b> <b>starting</b> <b>amounts</b><b> of </b><b>cells</b><b>.<br /> </b><br /> Chromatin preparation has been performed on 7 M K562 cells using the ChIPmentation Kit for Histones (Cat. no. C01011009) and 24 SI for ChIPmentation (Cat. No. C01011031). Diluted chromatin from 100.000, 10.000 and 5.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003). A. Distribution of the ChIPmentation readsets in a representative region of the genome. B., C. and D. Comparison of the top 40% peaks from 100.000 (B.), 10,000 (C.) and 5.000 (D.) cells with ENCODE dataset.</small></p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-5.png" /></p>
<p><small><b>Figure 2: </b><b>ChIPmentation</b><b> sequencing results.</b></small></p>
<p>Chromatin preparation has been performed on 7 M HeLa cells using the ChIPmentation Kit for Histones and 24 SI for ChIPmentation. Diluted chromatin from 100.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003) and H3K27me3 (Cat. no. C15410195) and IgG (Cat. no. C15410206).</p>',
'label2' => 'Additional solutions compatible with ChIPmentation Kit for Histones ',
'info2' => '<p><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">Chromatin shearing optimization kit - Low SDS (</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">iDeal</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells"> Kit for Histones)</a> optimizes chromatin shearing, a critical step for ChIP.</p>
<p><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">ChIP</a><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">-seq grade anti-histone antibodies</a> provide high yields with excellent specificity and sensitivity.</p>
<p>For fast and efficient isolation of magnetic beads we recommend the magnetic racks <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag0.2</a>.</p>
<p>Primer indexes for tagmenteted libraries:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><span> </span>libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a><span> </span><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"><span> </span>libraries Cat. No. C01011032</a></li>
</ul>
<p>The kit ChIPmentation for Histones is validated on the <a href="https://www.diagenode.com/en/categories/ip-star">IP-Star Compact System </a>and the corresponding protocol is included in the manual.</p>',
'label3' => '',
'info3' => '',
'format' => '4 chrom. prep./24 IPs',
'catalog_number' => 'C01011009',
'old_catalog_number' => '',
'sf_code' => 'C01011009-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '1865',
'price_USD' => '2235',
'price_GBP' => '1730',
'price_JPY' => '335700',
'price_CNY' => '',
'price_AUD' => '5588',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'chipmentation-kit-for-histones',
'meta_title' => 'ChIPmentation Kit for Histones',
'meta_keywords' => 'ChIPmentation Kit for Histones',
'meta_description' => 'ChIPmentation Kit for Histones',
'modified' => '2025-06-06 10:48:41',
'created' => '2021-01-28 10:29:40',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '3215',
'antibody_id' => null,
'name' => 'ATAC-seq package for tissue',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the <b>transposase Tn5</b> which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode’s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span> </span>Nuclei<span> </span>Extraction for ATAC-seq</a><span> </span>– optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span> </span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span> </span></a>– generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span>tagmented<span> </span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span> </span></a>– efficient multiplexing allowing for index hopping identification and filtering. </li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span> </span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" /> The project GENE-SWitCH leading to this application has received funding from the European Union’s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
'label1' => 'Method overview',
'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => 'Example of results',
'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode’s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork’s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => 'Additional solutions for ATAC-seq for tissue',
'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"> (Tn5 transposase) loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"> Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack: <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"> 0.2 ml – Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 rxns',
'catalog_number' => 'C01080006',
'old_catalog_number' => '',
'sf_code' => 'C01080006-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '2050',
'price_USD' => '2050',
'price_GBP' => '1765',
'price_JPY' => '369000',
'price_CNY' => '',
'price_AUD' => '5125',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'ATAC-seq-package-tissue-C01080006',
'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
'meta_keywords' => '',
'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
'modified' => '2023-04-06 11:06:44',
'created' => '2022-03-23 16:37:31',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 5 => array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
'id' => '3',
'position' => '4',
'parent_id' => null,
'name' => 'Kits',
'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode’s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg. </li>
</ul>
</div>
</div>',
'no_promo' => false,
'in_menu' => false,
'online' => true,
'tabular' => false,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'kits',
'cookies_tag_id' => null,
'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
'modified' => '2019-07-03 10:48:00',
'created' => '2014-11-13 22:28:36',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 1 => array(
'id' => '135',
'position' => '3',
'parent_id' => '15',
'name' => 'Library preparation for DNA sequencing',
'description' => '<p>Diagenode offers innovative DNA library preparation solutions such as a hyperactive tagmentase and the “capture and amplification by tailing and switching” (CATS), a ligation-free method to produce DNA libraries for next generation sequencing from low input amounts of DNA. Our powerfull ChIP-seq library preparation kits are also a great solution for low input DNA library preparation (discover our <a href="https://www.diagenode.com/en/categories/library-preparation-for-ChIP-seq">Diagenode MicroPlex family</a>). </p>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => true,
'all_format' => false,
'is_antibody' => false,
'slug' => 'library-preparation-for-dna-sequencing',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Library preparation for DNA sequencing | Diagenode',
'modified' => '2022-06-21 17:02:57',
'created' => '2018-03-22 09:34:18',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 2 => array(
'id' => '141',
'position' => '0',
'parent_id' => '86',
'name' => 'Tagmentation enzymes',
'description' => '',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'tagmentation-enzymes',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Tagmentation enzymes',
'modified' => '2020-03-24 17:49:07',
'created' => '2020-03-24 16:53:13',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
)
),
'Document' => array(
(int) 0 => array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
[maximum depth reached]
)
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
'id' => '1834',
'name' => 'https://www.diagenode.com/img/product/kits/tagmentation/StandardizedTagmentage-imgProduct.png',
'alt' => 'Standardized Tagmentase Product Image',
'modified' => '2025-05-28 17:01:35',
'created' => '2025-05-28 17:01:35',
'ProductsImage' => array(
[maximum depth reached]
)
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
'id' => '5151',
'name' => 'Quantitative measurement of phenotype dynamics during cancer drug resistance evolution using genetic barcoding',
'authors' => 'Whiting, F.J.H., Mossner, M., Gabbutt, C. et al. ',
'description' => '<section aria-labelledby="Abs1" data-title="Abstract" lang="en">
<div class="c-article-section" id="Abs1-section">
<div class="c-article-section__content" id="Abs1-content">
<p style="text-align: justify;">Cancer treatment frequently fails due to the evolution of drug-resistant cell phenotypes driven by genetic or non-genetic changes. The origin, timing, and rate of spread of these adaptations are critical for understanding drug resistance mechanisms but remain challenging to observe directly. We present a mathematical framework to infer drug resistance dynamics from genetic lineage tracing and population size data without direct measurement of resistance phenotypes. Simulation experiments demonstrate that the framework accurately recovers ground-truth evolutionary dynamics. Experimental evolution to 5-Fu chemotherapy in colorectal cancer cell lines SW620 and HCT116 validates the framework. In SW620 cells, a stable pre-existing resistant subpopulation was inferred, whereas in HCT116 cells, resistance emerged through phenotypic switching into a slow-growing resistant state with stochastic progression to full resistance. Functional assays, including scRNA-seq and scDNA-seq, validate these distinct evolutionary routes. This framework facilitates rapid characterisation of resistance mechanisms across diverse experimental settings.</p>
</div>
</div>
</section>',
'date' => '2025-06-20',
'pmid' => 'https://www.nature.com/articles/s41467-025-59479-7',
'doi' => 'https://doi.org/10.1038/s41467-025-59479-7',
'modified' => '2025-06-30 16:19:45',
'created' => '2025-06-30 16:19:45',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '5132',
'name' => 'Androgen receptor-mediated assisted loading of the glucocorticoid receptor modulates transcriptional responses in prostate cancer cells',
'authors' => 'Hiltunen, Johannes et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor NR3C1 (also known as GR) is well-documented, wherein AR suppression by antiandrogen therapy leads to elevated GR levels, enabling GR to compensate for and replace AR signaling. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer remain elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</p>
</div>
</div>',
'date' => '2025-06-02',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40456604/',
'doi' => '10.1101/gr.280224.124',
'modified' => '2025-06-06 15:50:05',
'created' => '2025-06-06 15:50:05',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '5133',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Schwaemmle, Hanna et al.',
'description' => '<p id="Par1" style="text-align: justify;">The SWI/SNF (or BAF) complex is an essential chromatin remodeler, which is frequently mutated in cancer and neurodevelopmental disorders. These are often heterozygous loss-of-function mutations, indicating a dosage-sensitive role for SWI/SNF subunits. However, the molecular mechanisms regulating SWI/SNF subunit dosage to ensure complex assembly remain largely unexplored. We performed a CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified<span> </span><em>Mlf2</em><span> </span>and<span> </span><em>Rbm15</em><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, promotes SWI/SNF assembly and binding to chromatin. Rapid degradation of MLF2 reduces chromatin accessibility at sites that depend on high levels of SWI/SNF binding to maintain open chromatin. Next, we find that RBM15, part of the m<sup>6</sup>A writer complex, controls m<sup>6</sup>A modifications on specific SWI/SNF mRNAs to regulate subunit protein levels. Misregulation of m<sup>6</sup>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</p>
<section id="kwd-group1" class="kwd-group"></section>',
'date' => '2025-05-30',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC12125367/',
'doi' => '10.1038/s41467-025-60424-x',
'modified' => '2025-06-06 15:53:40',
'created' => '2025-06-06 15:53:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 3 => array(
'id' => '5116',
'name' => 'Menin-MLL1 complex cooperates with NF-Y to promote HCC survival',
'authors' => 'Dzama-Karels, M., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-2" style="text-align: justify;">Identification of new therapeutic targets in hepatocellular carcinoma (HCC) remains critical. Chromatin regulating complexes are frequently mutated or aberrantly expressed in HCC, suggesting dysregulation of chromatin environments is a key feature driving liver cancer. To investigate whether the altered chromatin state in HCC cells could be targeted, we designed and utilized an epigenome-focused CRISPR library that targets genes involved in chromatin regulation. This focused approach allowed us to test multiple HCC cell lines in both 2D and 3D growth conditions, which revealed striking differences in the essentiality of genes involved in ubiquitination and multiple chromatin regulators vital for HCC cell survival in 2D but whose loss promoted growth in 3D. We found the core subunits of the menin-MLL1 complex among the strongest essential genes for HCC survival in all screens and thoroughly characterized the mechanism through which the menin-MLL1 complex promotes HCC cell growth. Inhibition of the menin-MLL1 interaction led to global changes in occupancy of the complex with concomitant decreases in H3K4me3 and expression of genes involved in PI3K/AKT/mTOR signaling pathway. Menin inhibition affected chromatin accessibility in HCC cells, revealing that increased chromatin accessibility at sites not bound by menin-MLL1 was associated with the recruitment of the pioneer transcription factor complex NF-Y. A CRISPR/Cas9 screen of chromatin regulators in the presence of menin inhibitor SNDX-5613 revealed a significantly increased cell death when combined with<span> </span><em>NFYB</em><span> </span>knockout. Together these data show that menin-MLL1 is necessary for HCC cell survival and cooperates with NF-Y to regulate oncogenic gene transcription.</p>',
'date' => '2025-04-08',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.04.05.647381v1',
'doi' => 'https://doi.org/10.1101/2025.04.05.647381',
'modified' => '2025-04-25 11:50:22',
'created' => '2025-04-25 11:45:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '5145',
'name' => 'Eosinophil innate immune memory after bacterial skin infection promotes allergic lung inflammation',
'authors' => 'Radhouani, Mariem et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Microbial exposure at barrier interfaces drives development and balance of the immune system, but the consequences of local infections for systemic immunity and secondary inflammation are unclear. Here, we show that skin exposure to the bacterium<span> </span><i>Staphylococcus aureus</i><span> </span>persistently shapes the immune system of mice with specific impact on progenitor and mature bone marrow neutrophil and eosinophil populations. The infection-imposed changes in eosinophils were long-lasting and associated with functional as well as imprinted epigenetic and metabolic changes. Bacterial exposure enhanced cutaneous allergic sensitization and resulted in exacerbated allergen-induced lung inflammation. Functional bone marrow eosinophil reprogramming and pulmonary allergen responses were driven by the alarmin interleukin-33 and the complement cleavage fragment C5a. Our study highlights the systemic impact of skin inflammation and reveals mechanisms of eosinophil innate immune memory and organ cross-talk that modulate systemic responses to allergens.</p>
</div>
</div>',
'date' => '2025-04-04',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40184438/',
'doi' => '10.1126/sciimmunol.adp6231',
'modified' => '2025-06-19 17:24:58',
'created' => '2025-06-19 17:24:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 5 => array(
'id' => '5115',
'name' => 'SIRT6 activator fucoidan extends healthspan and lifespan in aged wild-type mice',
'authors' => 'Biashad, S., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-4" style="text-align: justify;">SIRT6 is a protein deacylase, deacetylase, and mono-ADP-ribosylase (mADPr) regulating biological pathways important for longevity including DNA repair and silencing of LINE1 retrotransposons. SIRT6 knockout mice die by 30 days of age, whereas SIRT6 overexpression increases lifespan in male mice. Finding safe pharmacological activators of SIRT6 would have clinical benefits. Fucoidan, a polysaccharide purified from brown seaweed, has been identified as an activator of SIRT6 deacetylation activity. Here, we show that fucoidan also activates SIRT6 mADPr activity, which was shown to be elevated in certain human centenarians. Administering fucoidan to aged mice led to a significant increase in median lifespan in male mice. Both male and female mice demonstrated a marked reduction in frailty and epigenetic age. Fucoidan-treated mice showed repression of LINE1 elements suggesting that the beneficial effects of fucoidan are mediated, at least in part, by SIRT6. As brown seaweed rich in fucoidan is a popular food item in South Korea and Japan, countries with the highest life expectancy, we propose that fucoidan supplementation should be explored as a safe strategy for activating SIRT6 and improving human healthspan and lifespan.</p>',
'date' => '2025-03-26',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.03.24.645072v1',
'doi' => 'https://doi.org/10.1101/2025.03.24.645072',
'modified' => '2025-04-25 11:51:56',
'created' => '2025-04-25 11:42:49',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 6 => array(
'id' => '5018',
'name' => 'A20’s Linear Ubiquitin Binding Motif Restrains Pathogenic Activation of TH17/22 cells and IL-22 Driven Enteritis',
'authors' => 'Christopher John Bowman et al.',
'description' => '<p><span>A20, encoded by the </span><em>TNFAIP3</em><span><span> </span>gene, is a protein linked to Crohn's disease and celiac disease in humans. We now find that mice expressing point mutations in A20's M1 ubiquitin binding motif (ZF7) spontaneously develop proximate enteritis that requires both luminal microbes and T cells. Cellular and transcriptomic profiling reveal expansion of TH17/22 cells and aberrant expression of IL-17A and IL-22 in intestinal lamina propria of A20</span><sup>ZF7</sup><span><span> </span>mice. While deletion of IL-17A from A20</span><sup>ZF7/ZF7</sup><span><span> </span>mice exacerbates enteritis, deletion of IL-22 abrogates intestinal epithelial cell hyperproliferation, barrier dysfunction, and alarmin expression. A20</span><sup>ZF7/ZF7</sup><span><span> </span>TH17/22 cells autonomously express more RORγt and IL-22 after differentiation in vitro. ATAC sequencing identified an enhancer region upstream of the<span> </span></span><em>Il22</em><span><span> </span>gene in A20</span><sup>ZF7/ZF7</sup><span><span> </span>T cells, and this enhancer demonstrated increased activating histone acetylation coupled with exaggerated<span> </span></span><em>Il22</em><span><span> </span>transcription. Finally, CRISPR/Cas9-mediated ablation of A20</span><sup>ZF7</sup><span><span> </span>in human T cells increases RORγt expression and<span> </span></span><em>IL22</em><span><span> </span>transcription. These studies link A20's M1 ubiquitin binding function with RORγt expression, epigenetic activation of TH17/22 cells, and IL-22 driven enteritis.</span></p>',
'date' => '2025-01-02',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.12.31.630926v1',
'doi' => 'https://doi.org/10.1101/2024.12.31.630926',
'modified' => '2025-01-06 11:53:07',
'created' => '2025-01-06 11:53:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 7 => array(
'id' => '5051',
'name' => 'Gene mobility elements mediate cell type specific genome organization and radial gene movement in vivo',
'authors' => 'Tanguy Lucas et al.',
'description' => '<p><span>Understanding the level of genome organization that governs gene regulation remains a challenge despite advancements in chromatin profiling techniques. Cell type specific chromatin architectures may be obscured by averaging heterogeneous cell populations. Here we took a reductionist perspective, starting with the relocation of the </span><em>hunchback</em><span><span> </span>gene to the nuclear lamina in<span> </span></span><em>Drosophila</em><span><span> </span>neuroblasts. We previously found that this event terminates competence to produce early-born neurons and is mediated by an intronic 250 base-pair element, which we term gene mobility element (GME). Here we found over 800 putative GMEs globally that are chromatin accessible and are Polycomb (PcG) target sites. GMEs appear to be distinct from PcG response elements, however, which are largely chromatin inaccessible in neuroblasts. Performing<span> </span></span><em>in situ</em><span><span> </span>Hi-C of purified neuroblasts, we found that GMEs form megabase-scale chromatin interactions, spanning multiple topologically associated domain borders, preferentially contacting other GMEs. These interactions are cell type and stage-specific. Notably, GMEs undergo developmentally- timed mobilization to/from the neuroblast nuclear lamina, and domain swapping a GFP reporter transgene intron with a GME relocates the transgene to the nuclear lamina in embryos. We propose that GMEs constitute a genome organizational framework and mediate gene-to-lamina mobilization during progenitor competence state transitions<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-12-01',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.30.626181v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.30.626181',
'modified' => '2025-02-26 16:57:17',
'created' => '2025-02-26 16:57:17',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 8 => array(
'id' => '5002',
'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
'authors' => 'Michelle Lee Lynskey et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the α-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
'date' => '2024-11-26',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
'doi' => '10.1016/j.celrep.2024.114964',
'modified' => '2024-11-12 09:41:40',
'created' => '2024-11-12 09:41:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 9 => array(
'id' => '5052',
'name' => 'Steroid receptor-assisted loading modulates transcriptional responses in prostate cancer cells',
'authors' => 'Johannes Hiltunen et al.',
'description' => '<p><span>Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor (GR) is well-documented, where GR replaces antiandrogen-inactivated AR becoming the disease driver. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer have remained elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Intriguingly, pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</span></p>',
'date' => '2024-11-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.15.623719v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.15.623719',
'modified' => '2025-02-26 16:58:52',
'created' => '2025-02-26 16:58:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 10 => array(
'id' => '4996',
'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
'authors' => 'Akifumi Uota et al.',
'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific </span><em>Armc5</em><span><span> </span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span> </span></span><em>Scd1</em><span><span> </span>locus in the WAT of<span> </span></span><em>Armc5</em><span><span> </span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span> </span></span><em>Scd</em><span>. Mechanistically, disruption of<span> </span></span><em>Armc5</em><span><span> </span>restored decreased full-length SREBF1 in CHO cells deficient for<span> </span></span><em>Scap</em><span>. Overexpression of<span> </span></span><em>Scap</em><span><span> </span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span> </span></span><em>Armc5</em><span><span> </span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-11-02',
'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
'modified' => '2024-11-05 08:33:28',
'created' => '2024-11-05 08:33:28',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 11 => array(
'id' => '5055',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Felix Ezequiel Gerbaldo et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (a chromVAR-limma workflow with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs—in our case NFkB—at the protein level.</span></p>',
'date' => '2024-10-23',
'pmid' => 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1011971',
'doi' => 'https://doi.org/10.1371/journal.pcbi.1011971',
'modified' => '2025-02-26 17:05:52',
'created' => '2025-02-26 17:05:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 12 => array(
'id' => '4985',
'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
'authors' => 'Alessia Bagattin et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1β mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1β partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1β recruits TOP1 and induces DNA relaxation around bookmarked HNF1β sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1β mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1β (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that HNF1β remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1β-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1β and TOP1, where a mutation, found in “maturity onset diabetes of the young” patients, disrupts their interaction. Importantly, HNF1β recruits TOP1 and induces DNA relaxation around HNF1β mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1β reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
'date' => '2024-10-08',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
'doi' => '10.1016/j.celrep.2024.114805',
'modified' => '2024-10-14 09:04:44',
'created' => '2024-10-14 09:04:44',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 13 => array(
'id' => '4969',
'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
'authors' => 'Ghosh S. et al.',
'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
'date' => '2024-09-12',
'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
'modified' => '2024-09-16 09:43:31',
'created' => '2024-09-16 09:43:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 14 => array(
'id' => '4970',
'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
'authors' => 'van Dender C. et al. ',
'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPARα, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPARα downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4α, which has a strong impact on the expression of several important nuclear receptors, including PPARα. HNF4α depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4α agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4α is crucial in tolerance to sepsis. In conclusion, hepatic HNF4α activity is decreased during sepsis, causing PPARα downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
'date' => '2024-09-11',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
'doi' => '10.1038/s44321-024-00130-1',
'modified' => '2024-09-16 09:49:27',
'created' => '2024-09-16 09:49:27',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 15 => array(
'id' => '5053',
'name' => 'Peripheral nervous system mediates body-wide stem cell activation for limb regeneration',
'authors' => 'Duygu Payzin-Dogru et al.',
'description' => '<p><span>Many species throughout the animal kingdom naturally regenerate complex body parts following amputation. Most research in appendage regeneration has focused on identifying mechanisms that influence cell behaviors in the remaining stump tissue immediately adjacent to the injury site. Roles for activation steps that occur outside of the injury site remain largely unexplored, yet they may be critical for the regeneration process and may also shape the evolution of regeneration. Here, we discovered a role for the peripheral nervous system (PNS) in stimulating a body-wide stem cell activation response to amputation that drives limb regeneration. Notably, this systemic response is mediated by innervation at both the injury site and in distant, uninjured tissues, and by several signaling pathways, including adrenergic signaling. This work challenges the predominant conceptual framework considering the injury site alone in the regenerative response and argues instead for brain-body axis in stem cell activation as a priming step upon which molecular cues at the injury site then build tissue.</span></p>',
'date' => '2024-08-29',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2021.12.29.474455v3.abstract',
'doi' => 'https://doi.org/10.1101/2021.12.29.474455',
'modified' => '2025-02-26 17:00:21',
'created' => '2025-02-26 17:00:21',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 16 => array(
'id' => '5056',
'name' => 'Rhabdomyosarcoma fusion oncoprotein initially pioneers a neural signature in vivo',
'authors' => 'Jack Kucinski et al.',
'description' => '<p><span>Fusion-positive rhabdomyosarcoma is an aggressive pediatric cancer molecularly characterized by arrested myogenesis. The defining genetic driver, PAX3::FOXO1, functions as a chimeric gain-of-function transcription factor. An incomplete understanding of PAX3::FOXO1’s in vivo epigenetic mechanisms has hindered therapeutic development. Here, we establish a PAX3::FOXO1 zebrafish injection model and semi-automated ChIP-seq normalization strategy to evaluate how PAX3::FOXO1 initially interfaces with chromatin in a developmental context. We investigated PAX3::FOXO1’s recognition of chromatin and subsequent transcriptional consequences. We find that PAX3::FOXO1 interacts with inaccessible chromatin through partial/homeobox motif recognition consistent with pioneering activity. However, PAX3::FOXO1-genome binding through a composite paired-box/homeobox motif alters chromatin accessibility and redistributes H3K27ac to activate neural transcriptional programs. We uncover neural signatures that are highly representative of clinical rhabdomyosarcoma gene expression programs that are enriched following chemotherapy. Overall, we identify partial/homeobox motif recognition as a new mode for PAX3::FOXO1 pioneer function and identify neural signatures as a potentially critical PAX3::FOXO1 tumor initiation event.</span></p>',
'date' => '2024-07-16',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.07.12.603270v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.07.12.603270',
'modified' => '2025-02-26 17:07:24',
'created' => '2025-02-26 17:07:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 17 => array(
'id' => '5058',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Hanna Schwaemmle et al.',
'description' => '<p><span>The SWI/SNF (or BAF) complex is an essential chromatin remodeler that regulates DNA accessibility at developmental genes and enhancers. SWI/SNF subunits are among the most frequently mutated genes in cancer and neurodevelopmental disorders. These mutations are often heterozygous loss-of-function alleles, indicating a dosage-sensitive role for SWI/SNF subunits in chromatin regulation. However, the molecular mechanisms that regulate SWI/SNF subunit dosage to ensure proper complex assembly remain largely unexplored. We performed a genome-wide CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified </span><em>Mlf2</em><span><span> </span>and<span> </span></span><em>Rbm15</em><span><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, regulates a subset of SWI/SNF target genes by promoting chromatin remodeling activity. Next, we find that RBM15, part of the m</span><sup>6</sup><span>A RNA methylation writer complex, controls m</span><sup>6</sup><span>A modifications on specific SWI/SNF mRNAs to regulate protein levels of these subunits. Misregulation of m</span><sup>6</sup><span>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</span></p>',
'date' => '2024-06-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.06.25.600572v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.06.25.600572',
'modified' => '2025-02-26 17:10:53',
'created' => '2025-02-26 17:10:53',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 18 => array(
'id' => '5061',
'name' => 'Clock-dependent chromatin accessibility rhythms regulate circadian transcription',
'authors' => 'Ye Yuan et al.',
'description' => '<p><span>Chromatin organization plays a crucial role in gene regulation by controlling the accessibility of DNA to transcription machinery. While significant progress has been made in understanding the regulatory role of clock proteins in circadian rhythms, how chromatin organization affects circadian rhythms remains poorly understood. Here, we employed ATAC-seq (Assay for Transposase-Accessible Chromatin with Sequencing) on FAC-sorted Drosophila clock neurons to assess genome-wide chromatin accessibility at dawn and dusk over the circadian cycle. We observed significant oscillations in chromatin accessibility at promoter and enhancer regions of hundreds of genes, with enhanced accessibility either at dusk or dawn, which correlated with their peak transcriptional activity. Notably, genes with enhanced accessibility at dusk were enriched with E-box motifs, while those more accessible at dawn were enriched with VRI/PDP1-box motifs, indicating that they are regulated by the core circadian feedback loops, PER/CLK and VRI/PDP1, respectively. Further, we observed a complete loss of chromatin accessibility rhythms in </span><em>per</em><sup><em>01</em></sup><span><span> </span>null mutants, with chromatin consistently accessible at both dawn and dusk, underscoring the critical role of Period protein in driving chromatin compaction during the repression phase at dawn. Together, this study demonstrates the significant role of chromatin organization in circadian regulation, revealing how the interplay between clock proteins and chromatin structure orchestrates the precise timing of biological processes throughout the day. This work further implies that variations in chromatin accessibility might play a central role in the generation of diverse circadian gene expression patterns in clock neurons.</span></p>',
'date' => '2024-05-28',
'pmid' => 'https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011278',
'doi' => 'https://doi.org/10.1371/journal.pgen.1011278',
'modified' => '2025-02-26 17:21:25',
'created' => '2025-02-26 17:21:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 19 => array(
'id' => '5062',
'name' => 'PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites',
'authors' => 'Andrew Dimond et al.',
'description' => '<p><span>PBK/TOPK is a mitotic kinase implicated in haematological and non-haematological cancers. Here we show that the key haemopoietic regulators Ikaros and Aiolos require PBK-mediated phosphorylation to dissociate from chromosomes in mitosis. Eviction of Ikaros is rapidly reversed by addition of the PBK-inhibitor OTS514, revealing dynamic regulation by kinase and phosphatase activities. To identify more PBK targets, we analysed loss of mitotic phosphorylation events in </span><em>Pbk<sup>−/−</sup></em><span>preB cells and performed proteomic comparisons on isolated mitotic chromosomes. Among a large pool of C2H2-zinc finger targets, PBK is essential for evicting the CCCTC-binding protein CTCF and zinc finger proteins encoded by<span> </span></span><em>Ikzf1</em><span>,<span> </span></span><em>Ikzf3</em><span>,<span> </span></span><em>Znf131</em><span><span> </span>and<span> </span></span><em>Zbtb11</em><span>. PBK-deficient cells were able to divide but showed altered chromatin accessibility and nucleosome positioning consistent with CTCF retention. Our studies reveal that PBK controls the dissociation of selected factors from condensing mitotic chromosomes and contributes to their compaction.</span></p>',
'date' => '2024-04-23',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.23.590758v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.04.23.590758',
'modified' => '2025-02-26 17:22:58',
'created' => '2025-02-26 17:22:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 20 => array(
'id' => '5057',
'name' => 'Widespread impact of nucleosome remodelers on transcription at cis-regulatory elements',
'authors' => 'Benjamin J. Patty et al.',
'description' => '<p><span>Nucleosome remodeling complexes and other regulatory factors work in concert to build a chromatin environment that directs the expression of a distinct set of genes in each cell using cis-regulatory elements (CREs), such as promoters and enhancers, that drive transcription of both mRNAs and CRE-associated non-coding RNAs (ncRNAs). Two classes of CRE-associated ncRNAs include upstream antisense RNAs (uaRNAs), which are transcribed divergently from a shared mRNA promoter, and enhancer RNAs (eRNAs), which are transcribed bidirectionally from active enhancers. The complicated network of CRE regulation by nucleosome remodelers remains only partially explored, with a focus on a select, limited number of remodelers. We endeavored to elucidate a remodeler-based regulatory network governing CRE-associated transcription (mRNA, eRNA, and uaRNA) in murine embryonic stem (ES) cells to test the hypothesis that many SNF2-family nucleosome remodelers collaborate to regulate the coding and non-coding transcriptome via alteration of underlying nucleosome architecture. Using depletion followed by transient transcriptome sequencing (TT-seq), we identified thousands of misregulated mRNAs and CRE-associated ncRNAs across the remodelers examined, identifying novel contributions by understudied remodelers in the regulation of coding and non-coding transcription. Our findings suggest that mRNA and eRNA transcription are coordinately co-regulated, while mRNA and uaRNAs sharing a common promoter are independently regulated. Subsequent mechanistic studies suggest that while remodelers SRCAP and CHD8 modulate transcription through classical mechanisms such as transcription factors and histone variants, a broad set of remodelers including SMARCAL1 indirectly contribute to transcriptional regulation through maintenance of genomic stability and proper Integrator complex localization. This study systematically examines the contribution of SNF2-remodelers to the CRE-associated transcriptome, identifying at least two classes for remodeler action.</span></p>',
'date' => '2024-04-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.12.589208v1',
'doi' => 'https://doi.org/10.1101/2024.04.12.589208',
'modified' => '2025-02-26 17:09:18',
'created' => '2025-02-26 17:09:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 21 => array(
'id' => '4926',
'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
'authors' => 'Cobb L. et all.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (>3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
'date' => '2024-03-22',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
'doi' => '10.1371/journal.pone.0300865',
'modified' => '2024-03-25 11:15:06',
'created' => '2024-03-25 11:15:06',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 22 => array(
'id' => '5059',
'name' => 'EP300/CREBBP acetyltransferase inhibition limits steroid receptor and FOXA1 signaling in prostate cancer cells',
'authors' => 'Jasmin Huttunen et al.',
'description' => '<p><span>The androgen receptor (AR) is a primary target for treating prostate cancer (PCa), forming the bedrock of its clinical management. Despite their efficacy, resistance often hampers AR-targeted therapies, necessitating new strategies against therapy-resistant PCa. These resistances involve various mechanisms, including AR splice variant overexpression and altered activities of transcription factors like the glucocorticoid receptor (GR) and FOXA1. These factors rely on common coregulators, such as EP300/CREBBP, suggesting a rationale for coregulator-targeted therapies. Our study explores EP300/CREBBP acetyltransferase inhibition’s impact on steroid receptor and FOXA1 signaling in PCa cells using genome-wide techniques. Results reveal that EP300/CREBBP inhibition significantly disrupts the AR-regulated transcriptome and receptor chromatin binding by reducing the AR-gene expression. Similarly, GR’s regulated transcriptome and receptor binding were hindered, not linked to reduced GR expression but to diminished FOXA1 chromatin binding, restricting GR signaling. Overall, our findings highlight how EP300/CREBBP inhibition distinctively curtails oncogenic transcription factors’ signaling, suggesting the potential of coregulatory-targeted therapies in PCa.</span></p>',
'date' => '2024-03-13',
'pmid' => 'https://link.springer.com/article/10.1007/s00018-024-05209-z',
'doi' => 'https://doi.org/10.1007/s00018-024-05209-z',
'modified' => '2025-02-26 17:12:18',
'created' => '2025-02-26 17:12:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 23 => array(
'id' => '4923',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Gerbaldo F. et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs – in our case NFkB – at the protein level.</span></p>',
'date' => '2024-03-10',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
'modified' => '2024-03-13 17:04:33',
'created' => '2024-03-13 17:04:33',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 24 => array(
'id' => '4918',
'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
'authors' => 'Katsuda T.',
'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
'date' => '2024-02-26',
'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
'modified' => '2024-02-29 11:59:10',
'created' => '2024-02-29 11:59:10',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 25 => array(
'id' => '5003',
'name' => 'Improved metagenome assemblies through selective enrichment of bacterial genomic DNA from eukaryotic host genomic DNA using ATAC-seq',
'authors' => 'Lindsey J Cantin et al.',
'description' => '<p><span>Genomics can be used to study the complex relationships between hosts and their microbiota. Many bacteria cannot be cultured in the laboratory, making it difficult to obtain adequate amounts of bacterial DNA and to limit host DNA contamination for the construction of metagenome-assembled genomes (MAGs). For example, </span><em>Wolbachia</em><span><span> </span>is a genus of exclusively obligate intracellular bacteria that live in a wide range of arthropods and some nematodes. While<span> </span></span><em>Wolbachia</em><span><span> </span>endosymbionts are frequently described as facultative reproductive parasites in arthropods, the bacteria are obligate mutualistic endosymbionts of filarial worms. Here, we achieve 50-fold enrichment of bacterial sequences using ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) with<span> </span></span><em>Brugia malayi</em><span><span> </span>nematodes, containing<span> </span></span><em>Wolbachia</em><span><span> </span>(</span><em>w</em><span>Bm). ATAC-seq uses the Tn5 transposase to cut and attach Illumina sequencing adapters to accessible DNA lacking histones, typically thought to be open chromatin. Bacterial and mitochondrial DNA in the lysates are also cut preferentially since they lack histones, leading to the enrichment of these sequences. The benefits of this include minimal tissue input (<1 mg of tissue), a quick protocol (<4 h), low sequencing costs, less bias, correct assembly of lateral gene transfers and no prior sequence knowledge required. We assembled the<span> </span></span><em>w</em><span>Bm genome with as few as 1 million Illumina short paired-end reads with >97% coverage of the published genome, compared to only 12% coverage with the standard gDNA libraries. We found significant bacterial sequence enrichment that facilitated genome assembly in previously published ATAC-seq data sets from human cells infected with<span> </span></span><em>Mycobacterium tuberculosis</em><span><span> </span>and<span> </span></span><em>C. elegans</em><span><span> </span>contaminated with their food source, the OP50 strain of<span> </span></span><em>E. coli</em><span>. These results demonstrate the feasibility and benefits of using ATAC-seq to easily obtain bacterial genomes to aid in symbiosis, infectious disease, and microbiome research.</span></p>',
'date' => '2024-02-15',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC10902005/',
'doi' => '10.3389/fmicb.2024.1352378',
'modified' => '2024-11-29 11:10:24',
'created' => '2024-11-29 11:10:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 26 => array(
'id' => '4889',
'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
'authors' => 'Klein D.C. et al. ',
'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
'date' => '2023-12-21',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
'doi' => '10.1158/2767-9764.CRC-23-0382',
'modified' => '2024-01-02 11:07:14',
'created' => '2024-01-02 11:07:14',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 27 => array(
'id' => '5054',
'name' => 'Revisiting chromatin packaging in mouse sperm',
'authors' => 'Qiangzong Yin et al. ',
'description' => '',
'date' => '2023-12-21',
'pmid' => 'https://genome.cshlp.org/content/33/12/2079.short',
'doi' => 'https://www.genome.org/cgi/doi/10.1101/gr.277845.123',
'modified' => '2025-02-26 17:03:24',
'created' => '2025-02-26 17:03:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 28 => array(
'id' => '5063',
'name' => 'A fast and inexpensive plate-based NGS library preparation method for insect genomics',
'authors' => 'Lauren Cobb et al.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we investigate a fast and economical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs stored under different conditions. Using a standardised input of 6ng DNA, library preparation costs were significantly reduced through the 6-fold dilution of a commercially available tagmentation enzyme. Costs were further suppressed by direct post-amplification pooling, skipping quality assessment of individual libraries. We find that reduced DNA yields associated with ethanol-based storage do not impede overall sequencing success. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By lowering data generation costs, broadening the scope of whole genome studies to include low yield DNA extracts and increasing throughput, we expect this protocol to be of significant value for a range of applications in the field of insect genomics.</span></p>',
'date' => '2023-11-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.11.24.568434v1.abstract',
'doi' => 'https://doi.org/10.1101/2023.11.24.568434',
'modified' => '2025-02-26 17:24:46',
'created' => '2025-02-26 17:24:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 29 => array(
'id' => '5060',
'name' => 'Therapeutic targeting of EP300/CBP by bromodomain inhibition in hematologic malignancies',
'authors' => 'Luciano Nicosia et al. ',
'description' => '<p><span>CCS1477 (inobrodib) is a potent, selective EP300/CBP bromodomain inhibitor which induces cell-cycle arrest and differentiation in hematologic malignancy model systems. In myeloid leukemia cells, it promotes rapid eviction of EP300/CBP from an enhancer subset marked by strong MYB occupancy and high H3K27 acetylation, with downregulation of the subordinate oncogenic network and redistribution to sites close to differentiation genes. In myeloma cells, CCS1477 induces eviction of EP300/CBP from </span><i>FGFR3</i><span>, the target of the common (4; 14) translocation, with redistribution away from IRF4-occupied sites to TCF3/E2A-occupied sites. In a subset of patients with relapsed or refractory disease, CCS1477 monotherapy induces differentiation responses in AML and objective responses in heavily pre-treated multiple myeloma.<span> </span></span><i>In vivo</i><span><span> </span>preclinical combination studies reveal synergistic responses to treatment with standard-of-care agents. Thus, CCS1477 exhibits encouraging preclinical and early-phase clinical activity by disrupting recruitment of EP300/CBP to enhancer networks occupied by critical transcription factors.</span></p>',
'date' => '2023-11-22',
'pmid' => 'https://www.cell.com/cancer-cell/fulltext/S1535-6108(23)00366-5',
'doi' => '10.1016/j.ccell.2023.11.001',
'modified' => '2025-02-26 17:15:25',
'created' => '2025-02-26 17:15:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 30 => array(
'id' => '4878',
'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
'authors' => 'Menon D.U. et al.',
'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
'date' => '2023-09-28',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
'modified' => '2023-11-10 14:53:09',
'created' => '2023-11-10 14:53:09',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 31 => array(
'id' => '4825',
'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
'authors' => 'Miyazaki S. et al.',
'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
'date' => '2023-07-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
'doi' => '10.1038/s42003-023-05148-8',
'modified' => '2023-08-01 13:30:58',
'created' => '2023-08-01 15:59:38',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 32 => array(
'id' => '4817',
'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
'authors' => 'Yamazaki M. et al.',
'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
'date' => '2023-04-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
'doi' => '10.15252/embj.2022112614',
'modified' => '2023-06-15 10:06:12',
'created' => '2023-06-13 21:11:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 33 => array(
'id' => '4757',
'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
'authors' => 'Cittaro D. et al.',
'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10× Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et al. (2022) and de Pretis and Cittaro (2022)..</p>',
'date' => '2023-03-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
'doi' => '10.1016/j.xpro.2023.102176',
'modified' => '2023-04-17 09:04:55',
'created' => '2023-04-14 13:41:22',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 34 => array(
'id' => '4742',
'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
'authors' => 'Zou Han et al.',
'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled 1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue 2 (EZH2) and nuclear factor I X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
'date' => '2023-02-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
'doi' => '10.1038/s41556-023-01093-0',
'modified' => '2023-03-14 09:41:24',
'created' => '2023-03-02 17:27:08',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 35 => array(
'id' => '4568',
'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
'authors' => 'Katsuda T. et al.',
'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
'date' => '2023-01-01',
'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
'doi' => '10.1101/2023.02.14.528556',
'modified' => '2023-04-11 10:26:02',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 36 => array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
)
),
'Testimonial' => array(
(int) 0 => array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
[maximum depth reached]
)
)
),
'Area' => array(),
'SafetySheet' => array()
)
$meta_canonical = 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul'
$fromEmail = 'dev.diagenode.com'
$country = 'US'
$countries_allowed = array(
(int) 0 => 'CA',
(int) 1 => 'US',
(int) 2 => 'IE',
(int) 3 => 'GB',
(int) 4 => 'DK',
(int) 5 => 'NO',
(int) 6 => 'SE',
(int) 7 => 'FI',
(int) 8 => 'NL',
(int) 9 => 'BE',
(int) 10 => 'LU',
(int) 11 => 'FR',
(int) 12 => 'DE',
(int) 13 => 'CH',
(int) 14 => 'AT',
(int) 15 => 'ES',
(int) 16 => 'IT',
(int) 17 => 'PT'
)
$outsource = false
$other_formats = array(
(int) 0 => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
(int) 1 => array(
'id' => '3243',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '1,25 U / 10 µl ',
'catalog_number' => 'C01070013-10',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '120',
'price_USD' => '120',
'price_GBP' => '105',
'price_JPY' => '21600',
'price_CNY' => '',
'price_AUD' => '300',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-10ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 10 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 17:45:47',
'created' => '2025-05-22 15:14:17',
'ProductsGroup' => array(
'id' => '431',
'product_id' => '3243',
'group_id' => '368'
)
),
(int) 2 => array(
'id' => '3245',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '10 U / 80 µl',
'catalog_number' => 'C01070013-80',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '835',
'price_USD' => '835',
'price_GBP' => '715',
'price_JPY' => '150300',
'price_CNY' => '',
'price_AUD' => '2088',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-80ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 80 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:35',
'created' => '2025-05-27 23:38:24',
'ProductsGroup' => array(
'id' => '433',
'product_id' => '3245',
'group_id' => '368'
)
),
(int) 3 => array(
'id' => '3247',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '50 U / 400 µl',
'catalog_number' => 'C01070013-400',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '3200',
'price_USD' => '3200',
'price_GBP' => '2740',
'price_JPY' => '576000',
'price_CNY' => '',
'price_AUD' => '8000',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-400ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 400 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:07',
'created' => '2025-05-27 23:44:41',
'ProductsGroup' => array(
'id' => '435',
'product_id' => '3247',
'group_id' => '368'
)
),
(int) 4 => array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
)
$pro = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
'id' => '216',
'product_id' => '3244',
'testimonial_id' => '82'
)
)
$related_products = '<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011034</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011036</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3185" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3185" id="CartAdd/3185Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3185" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set II</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set2" data-reveal-id="cartModal-3185" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set II</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011037</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3206" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3206" id="CartAdd/3206Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3206" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set III</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set3" data-reveal-id="cartModal-3206" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set III</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/chipmentation-kit-for-histones"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011009</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3184" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3184" id="CartAdd/3184Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3184" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ChIPmentation Kit for Histones</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="chipmentation-kit-for-histones" data-reveal-id="cartModal-3184" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ChIPmentation Kit for Histones</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01080006</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ATAC-seq package for tissue</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01019043</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">Tagmentation Buffer (2x)</h6>
</div>
</div>
</li>
'
$related = array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
'id' => '5032',
'product_id' => '3244',
'related_id' => '3162'
),
'Image' => array(
(int) 0 => array(
'id' => '1776',
'name' => 'product/kits/kit-icon.png',
'alt' => 'Kit icon',
'modified' => '2019-04-09 12:06:37',
'created' => '2018-03-15 15:51:02',
'ProductsImage' => array(
[maximum depth reached]
)
)
)
)
$rrbs_service = array(
(int) 0 => (int) 1894,
(int) 1 => (int) 1895
)
$chipseq_service = array(
(int) 0 => (int) 2683,
(int) 1 => (int) 1835,
(int) 2 => (int) 1836,
(int) 3 => (int) 2684,
(int) 4 => (int) 1838,
(int) 5 => (int) 1839,
(int) 6 => (int) 1856
)
$labelize = object(Closure) {
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
'id' => '3322',
'product_id' => '3244',
'document_id' => '1191'
)
)
$publication = array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
'id' => '8387',
'product_id' => '3244',
'publication_id' => '4660'
)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'CustomErrorHandler::handleError() - APP/Lib/CustomErrorHandler.php, line 9
include - APP/View/Products/view.ctp, line 747
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1055
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118
(Notice): Undefined variable: header [APP/View/Products/view.ctp, line 747]Code Context $errorType = self::getErrorType($code);
self::logToDatabase( $errorType, $description, $file, $line);
return parent::handleError( $errorType, $description, $file, $line, $context);
$viewFile = '/var/www/dev.diagenode.com/app/View/Products/view.ctp'
$dataForView = array(
'language' => 'en',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'product' => array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
[maximum depth reached]
),
'Master' => array(
[maximum depth reached]
),
'Product' => array(
[maximum depth reached]
)
),
'Related' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
)
),
'Document' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
),
(int) 6 => array(
[maximum depth reached]
),
(int) 7 => array(
[maximum depth reached]
),
(int) 8 => array(
[maximum depth reached]
),
(int) 9 => array(
[maximum depth reached]
),
(int) 10 => array(
[maximum depth reached]
),
(int) 11 => array(
[maximum depth reached]
),
(int) 12 => array(
[maximum depth reached]
),
(int) 13 => array(
[maximum depth reached]
),
(int) 14 => array(
[maximum depth reached]
),
(int) 15 => array(
[maximum depth reached]
),
(int) 16 => array(
[maximum depth reached]
),
(int) 17 => array(
[maximum depth reached]
),
(int) 18 => array(
[maximum depth reached]
),
(int) 19 => array(
[maximum depth reached]
),
(int) 20 => array(
[maximum depth reached]
),
(int) 21 => array(
[maximum depth reached]
),
(int) 22 => array(
[maximum depth reached]
),
(int) 23 => array(
[maximum depth reached]
),
(int) 24 => array(
[maximum depth reached]
),
(int) 25 => array(
[maximum depth reached]
),
(int) 26 => array(
[maximum depth reached]
),
(int) 27 => array(
[maximum depth reached]
),
(int) 28 => array(
[maximum depth reached]
),
(int) 29 => array(
[maximum depth reached]
),
(int) 30 => array(
[maximum depth reached]
),
(int) 31 => array(
[maximum depth reached]
),
(int) 32 => array(
[maximum depth reached]
),
(int) 33 => array(
[maximum depth reached]
),
(int) 34 => array(
[maximum depth reached]
),
(int) 35 => array(
[maximum depth reached]
),
(int) 36 => array(
[maximum depth reached]
)
),
'Testimonial' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Area' => array(),
'SafetySheet' => array()
),
'meta_canonical' => 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul',
'fromEmail' => 'dev.diagenode.com'
)
$language = 'en'
$meta_keywords = ''
$meta_description = 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. '
$meta_title = 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode'
$product = array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
'id' => '368',
'name' => 'C01070013',
'product_id' => '3246',
'modified' => '2025-05-28 18:57:02',
'created' => '2025-05-27 23:47:46'
),
'Master' => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
'Product' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
)
)
),
'Related' => array(
(int) 0 => array(
'id' => '3158',
'antibody_id' => null,
'name' => '24 UDI for Tagmented libraries - Set I',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries – Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011034',
'old_catalog_number' => '',
'sf_code' => 'C01011034-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2024-05-15 10:25:12',
'created' => '2020-12-08 15:26:23',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '3185',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set II',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> <strong>24 UDI for tagmented libraries - Set II</strong><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<div id="info1" class="content active">
<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011036',
'old_catalog_number' => '',
'sf_code' => 'C01011036-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set2',
'meta_title' => '24 unique dual indexes for tagmented libraries set 2',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-01-09 19:07:24',
'created' => '2021-02-25 11:36:33',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '3206',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set III',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries </strong>includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation</a><a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns"> for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation</a><a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones"> Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2" target="_blank">24 UDI for tagmented libraries - Set II</a><br /> 24 UDI for tagmented libraries - Set III</p>
<p><br />Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries sets </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011037',
'old_catalog_number' => '',
'sf_code' => 'C01011037-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set3',
'meta_title' => '',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-04-06 12:02:03',
'created' => '2021-10-21 15:29:18',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 3 => array(
'id' => '3184',
'antibody_id' => null,
'name' => 'ChIPmentation Kit for Histones',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/chipmentation-for-histones-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ChIPmentation</b> is a method that combines <b>chromatin </b><b>immunoprecipiation</b> and <b>tagmentation</b><b>-based library preparation </b>using a fast and robust ChIP-seq protocol for studying <b>protein/DNA interactions</b>. In this method, following chromatin immunoprecipitation, the sequencing libraries are created directly on the chromatin-antibody-beads complex by the Tagmentase (Tn5 transposase) loaded with sequencing adapters. </p>
<p>The <b>ChIPmentation</b><b> Kit for Histones </b>includes all reagents for chromatin preparation, chromatin immunoprecipitation and library preparation using tagmentation. The <b>primer indexes </b>for multiplexing are <b>not included</b> in the kit and have to be purchase separately:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for </a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"> libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for </a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a> <a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for </a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"> libraries Cat. No. C01011032</a></li>
</ul>
<p><b>Benefits of the </b><b>ChIPmentation</b><b> system for histone </b><b>ChIP</b><b>-seq</b></p>
<ul>
<li>Easier and faster than classical ChIP-seq</li>
<li>Validated for various histone marks for a standard amount of cells</li>
<li>Generate high quality sequencing data</li>
</ul>
<p>For low input samples (10,000 cells) we recommend the <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">µChIPmentation kit for Histones</a>.</p>
<p>For ChIP-seq on transcription factors we recommend the <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">iDeal</a> <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">ChIP-seq</a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns"> for transcription </a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">factors</a> + <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a></p>',
'label1' => 'Validation',
'info1' => '<p>The Diagenode ChIPmentation technology has been tested on histone marks and compared to available datasets from the ENCODE project (Figure 1). ChIPmentation generated high quality data with low background. In addition, more than 99% of the top 40% peaks obtained with auto-ChIPmentation overlap with ENCODE datasets, which shows that ChIP-seq data obtained with ChIPmentation are highly reliable.</p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-1.png" /></p>
<div class="row">
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-2.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-3.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-4.png" /></div>
</div>
<p><small><b>Figure 1: </b><b>ChIPmentation</b> <b>sequencing</b> <b>results</b> <b>obtained</b> <b>from</b> <b>decreasing</b> <b>starting</b> <b>amounts</b><b> of </b><b>cells</b><b>.<br /> </b><br /> Chromatin preparation has been performed on 7 M K562 cells using the ChIPmentation Kit for Histones (Cat. no. C01011009) and 24 SI for ChIPmentation (Cat. No. C01011031). Diluted chromatin from 100.000, 10.000 and 5.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003). A. Distribution of the ChIPmentation readsets in a representative region of the genome. B., C. and D. Comparison of the top 40% peaks from 100.000 (B.), 10,000 (C.) and 5.000 (D.) cells with ENCODE dataset.</small></p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-5.png" /></p>
<p><small><b>Figure 2: </b><b>ChIPmentation</b><b> sequencing results.</b></small></p>
<p>Chromatin preparation has been performed on 7 M HeLa cells using the ChIPmentation Kit for Histones and 24 SI for ChIPmentation. Diluted chromatin from 100.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003) and H3K27me3 (Cat. no. C15410195) and IgG (Cat. no. C15410206).</p>',
'label2' => 'Additional solutions compatible with ChIPmentation Kit for Histones ',
'info2' => '<p><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">Chromatin shearing optimization kit - Low SDS (</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">iDeal</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells"> Kit for Histones)</a> optimizes chromatin shearing, a critical step for ChIP.</p>
<p><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">ChIP</a><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">-seq grade anti-histone antibodies</a> provide high yields with excellent specificity and sensitivity.</p>
<p>For fast and efficient isolation of magnetic beads we recommend the magnetic racks <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag0.2</a>.</p>
<p>Primer indexes for tagmenteted libraries:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><span> </span>libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a><span> </span><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"><span> </span>libraries Cat. No. C01011032</a></li>
</ul>
<p>The kit ChIPmentation for Histones is validated on the <a href="https://www.diagenode.com/en/categories/ip-star">IP-Star Compact System </a>and the corresponding protocol is included in the manual.</p>',
'label3' => '',
'info3' => '',
'format' => '4 chrom. prep./24 IPs',
'catalog_number' => 'C01011009',
'old_catalog_number' => '',
'sf_code' => 'C01011009-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '1865',
'price_USD' => '2235',
'price_GBP' => '1730',
'price_JPY' => '335700',
'price_CNY' => '',
'price_AUD' => '5588',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'chipmentation-kit-for-histones',
'meta_title' => 'ChIPmentation Kit for Histones',
'meta_keywords' => 'ChIPmentation Kit for Histones',
'meta_description' => 'ChIPmentation Kit for Histones',
'modified' => '2025-06-06 10:48:41',
'created' => '2021-01-28 10:29:40',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '3215',
'antibody_id' => null,
'name' => 'ATAC-seq package for tissue',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the <b>transposase Tn5</b> which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode’s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span> </span>Nuclei<span> </span>Extraction for ATAC-seq</a><span> </span>– optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span> </span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span> </span></a>– generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span>tagmented<span> </span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span> </span></a>– efficient multiplexing allowing for index hopping identification and filtering. </li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span> </span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" /> The project GENE-SWitCH leading to this application has received funding from the European Union’s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
'label1' => 'Method overview',
'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => 'Example of results',
'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode’s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork’s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => 'Additional solutions for ATAC-seq for tissue',
'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"> (Tn5 transposase) loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"> Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack: <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"> 0.2 ml – Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 rxns',
'catalog_number' => 'C01080006',
'old_catalog_number' => '',
'sf_code' => 'C01080006-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '2050',
'price_USD' => '2050',
'price_GBP' => '1765',
'price_JPY' => '369000',
'price_CNY' => '',
'price_AUD' => '5125',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'ATAC-seq-package-tissue-C01080006',
'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
'meta_keywords' => '',
'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
'modified' => '2023-04-06 11:06:44',
'created' => '2022-03-23 16:37:31',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 5 => array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
'id' => '3',
'position' => '4',
'parent_id' => null,
'name' => 'Kits',
'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode’s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg. </li>
</ul>
</div>
</div>',
'no_promo' => false,
'in_menu' => false,
'online' => true,
'tabular' => false,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'kits',
'cookies_tag_id' => null,
'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
'modified' => '2019-07-03 10:48:00',
'created' => '2014-11-13 22:28:36',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 1 => array(
'id' => '135',
'position' => '3',
'parent_id' => '15',
'name' => 'Library preparation for DNA sequencing',
'description' => '<p>Diagenode offers innovative DNA library preparation solutions such as a hyperactive tagmentase and the “capture and amplification by tailing and switching” (CATS), a ligation-free method to produce DNA libraries for next generation sequencing from low input amounts of DNA. Our powerfull ChIP-seq library preparation kits are also a great solution for low input DNA library preparation (discover our <a href="https://www.diagenode.com/en/categories/library-preparation-for-ChIP-seq">Diagenode MicroPlex family</a>). </p>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => true,
'all_format' => false,
'is_antibody' => false,
'slug' => 'library-preparation-for-dna-sequencing',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Library preparation for DNA sequencing | Diagenode',
'modified' => '2022-06-21 17:02:57',
'created' => '2018-03-22 09:34:18',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 2 => array(
'id' => '141',
'position' => '0',
'parent_id' => '86',
'name' => 'Tagmentation enzymes',
'description' => '',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'tagmentation-enzymes',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Tagmentation enzymes',
'modified' => '2020-03-24 17:49:07',
'created' => '2020-03-24 16:53:13',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
)
),
'Document' => array(
(int) 0 => array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
[maximum depth reached]
)
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
'id' => '1834',
'name' => 'https://www.diagenode.com/img/product/kits/tagmentation/StandardizedTagmentage-imgProduct.png',
'alt' => 'Standardized Tagmentase Product Image',
'modified' => '2025-05-28 17:01:35',
'created' => '2025-05-28 17:01:35',
'ProductsImage' => array(
[maximum depth reached]
)
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
'id' => '5151',
'name' => 'Quantitative measurement of phenotype dynamics during cancer drug resistance evolution using genetic barcoding',
'authors' => 'Whiting, F.J.H., Mossner, M., Gabbutt, C. et al. ',
'description' => '<section aria-labelledby="Abs1" data-title="Abstract" lang="en">
<div class="c-article-section" id="Abs1-section">
<div class="c-article-section__content" id="Abs1-content">
<p style="text-align: justify;">Cancer treatment frequently fails due to the evolution of drug-resistant cell phenotypes driven by genetic or non-genetic changes. The origin, timing, and rate of spread of these adaptations are critical for understanding drug resistance mechanisms but remain challenging to observe directly. We present a mathematical framework to infer drug resistance dynamics from genetic lineage tracing and population size data without direct measurement of resistance phenotypes. Simulation experiments demonstrate that the framework accurately recovers ground-truth evolutionary dynamics. Experimental evolution to 5-Fu chemotherapy in colorectal cancer cell lines SW620 and HCT116 validates the framework. In SW620 cells, a stable pre-existing resistant subpopulation was inferred, whereas in HCT116 cells, resistance emerged through phenotypic switching into a slow-growing resistant state with stochastic progression to full resistance. Functional assays, including scRNA-seq and scDNA-seq, validate these distinct evolutionary routes. This framework facilitates rapid characterisation of resistance mechanisms across diverse experimental settings.</p>
</div>
</div>
</section>',
'date' => '2025-06-20',
'pmid' => 'https://www.nature.com/articles/s41467-025-59479-7',
'doi' => 'https://doi.org/10.1038/s41467-025-59479-7',
'modified' => '2025-06-30 16:19:45',
'created' => '2025-06-30 16:19:45',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '5132',
'name' => 'Androgen receptor-mediated assisted loading of the glucocorticoid receptor modulates transcriptional responses in prostate cancer cells',
'authors' => 'Hiltunen, Johannes et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor NR3C1 (also known as GR) is well-documented, wherein AR suppression by antiandrogen therapy leads to elevated GR levels, enabling GR to compensate for and replace AR signaling. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer remain elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</p>
</div>
</div>',
'date' => '2025-06-02',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40456604/',
'doi' => '10.1101/gr.280224.124',
'modified' => '2025-06-06 15:50:05',
'created' => '2025-06-06 15:50:05',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '5133',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Schwaemmle, Hanna et al.',
'description' => '<p id="Par1" style="text-align: justify;">The SWI/SNF (or BAF) complex is an essential chromatin remodeler, which is frequently mutated in cancer and neurodevelopmental disorders. These are often heterozygous loss-of-function mutations, indicating a dosage-sensitive role for SWI/SNF subunits. However, the molecular mechanisms regulating SWI/SNF subunit dosage to ensure complex assembly remain largely unexplored. We performed a CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified<span> </span><em>Mlf2</em><span> </span>and<span> </span><em>Rbm15</em><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, promotes SWI/SNF assembly and binding to chromatin. Rapid degradation of MLF2 reduces chromatin accessibility at sites that depend on high levels of SWI/SNF binding to maintain open chromatin. Next, we find that RBM15, part of the m<sup>6</sup>A writer complex, controls m<sup>6</sup>A modifications on specific SWI/SNF mRNAs to regulate subunit protein levels. Misregulation of m<sup>6</sup>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</p>
<section id="kwd-group1" class="kwd-group"></section>',
'date' => '2025-05-30',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC12125367/',
'doi' => '10.1038/s41467-025-60424-x',
'modified' => '2025-06-06 15:53:40',
'created' => '2025-06-06 15:53:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 3 => array(
'id' => '5116',
'name' => 'Menin-MLL1 complex cooperates with NF-Y to promote HCC survival',
'authors' => 'Dzama-Karels, M., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-2" style="text-align: justify;">Identification of new therapeutic targets in hepatocellular carcinoma (HCC) remains critical. Chromatin regulating complexes are frequently mutated or aberrantly expressed in HCC, suggesting dysregulation of chromatin environments is a key feature driving liver cancer. To investigate whether the altered chromatin state in HCC cells could be targeted, we designed and utilized an epigenome-focused CRISPR library that targets genes involved in chromatin regulation. This focused approach allowed us to test multiple HCC cell lines in both 2D and 3D growth conditions, which revealed striking differences in the essentiality of genes involved in ubiquitination and multiple chromatin regulators vital for HCC cell survival in 2D but whose loss promoted growth in 3D. We found the core subunits of the menin-MLL1 complex among the strongest essential genes for HCC survival in all screens and thoroughly characterized the mechanism through which the menin-MLL1 complex promotes HCC cell growth. Inhibition of the menin-MLL1 interaction led to global changes in occupancy of the complex with concomitant decreases in H3K4me3 and expression of genes involved in PI3K/AKT/mTOR signaling pathway. Menin inhibition affected chromatin accessibility in HCC cells, revealing that increased chromatin accessibility at sites not bound by menin-MLL1 was associated with the recruitment of the pioneer transcription factor complex NF-Y. A CRISPR/Cas9 screen of chromatin regulators in the presence of menin inhibitor SNDX-5613 revealed a significantly increased cell death when combined with<span> </span><em>NFYB</em><span> </span>knockout. Together these data show that menin-MLL1 is necessary for HCC cell survival and cooperates with NF-Y to regulate oncogenic gene transcription.</p>',
'date' => '2025-04-08',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.04.05.647381v1',
'doi' => 'https://doi.org/10.1101/2025.04.05.647381',
'modified' => '2025-04-25 11:50:22',
'created' => '2025-04-25 11:45:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '5145',
'name' => 'Eosinophil innate immune memory after bacterial skin infection promotes allergic lung inflammation',
'authors' => 'Radhouani, Mariem et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Microbial exposure at barrier interfaces drives development and balance of the immune system, but the consequences of local infections for systemic immunity and secondary inflammation are unclear. Here, we show that skin exposure to the bacterium<span> </span><i>Staphylococcus aureus</i><span> </span>persistently shapes the immune system of mice with specific impact on progenitor and mature bone marrow neutrophil and eosinophil populations. The infection-imposed changes in eosinophils were long-lasting and associated with functional as well as imprinted epigenetic and metabolic changes. Bacterial exposure enhanced cutaneous allergic sensitization and resulted in exacerbated allergen-induced lung inflammation. Functional bone marrow eosinophil reprogramming and pulmonary allergen responses were driven by the alarmin interleukin-33 and the complement cleavage fragment C5a. Our study highlights the systemic impact of skin inflammation and reveals mechanisms of eosinophil innate immune memory and organ cross-talk that modulate systemic responses to allergens.</p>
</div>
</div>',
'date' => '2025-04-04',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40184438/',
'doi' => '10.1126/sciimmunol.adp6231',
'modified' => '2025-06-19 17:24:58',
'created' => '2025-06-19 17:24:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 5 => array(
'id' => '5115',
'name' => 'SIRT6 activator fucoidan extends healthspan and lifespan in aged wild-type mice',
'authors' => 'Biashad, S., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-4" style="text-align: justify;">SIRT6 is a protein deacylase, deacetylase, and mono-ADP-ribosylase (mADPr) regulating biological pathways important for longevity including DNA repair and silencing of LINE1 retrotransposons. SIRT6 knockout mice die by 30 days of age, whereas SIRT6 overexpression increases lifespan in male mice. Finding safe pharmacological activators of SIRT6 would have clinical benefits. Fucoidan, a polysaccharide purified from brown seaweed, has been identified as an activator of SIRT6 deacetylation activity. Here, we show that fucoidan also activates SIRT6 mADPr activity, which was shown to be elevated in certain human centenarians. Administering fucoidan to aged mice led to a significant increase in median lifespan in male mice. Both male and female mice demonstrated a marked reduction in frailty and epigenetic age. Fucoidan-treated mice showed repression of LINE1 elements suggesting that the beneficial effects of fucoidan are mediated, at least in part, by SIRT6. As brown seaweed rich in fucoidan is a popular food item in South Korea and Japan, countries with the highest life expectancy, we propose that fucoidan supplementation should be explored as a safe strategy for activating SIRT6 and improving human healthspan and lifespan.</p>',
'date' => '2025-03-26',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.03.24.645072v1',
'doi' => 'https://doi.org/10.1101/2025.03.24.645072',
'modified' => '2025-04-25 11:51:56',
'created' => '2025-04-25 11:42:49',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 6 => array(
'id' => '5018',
'name' => 'A20’s Linear Ubiquitin Binding Motif Restrains Pathogenic Activation of TH17/22 cells and IL-22 Driven Enteritis',
'authors' => 'Christopher John Bowman et al.',
'description' => '<p><span>A20, encoded by the </span><em>TNFAIP3</em><span><span> </span>gene, is a protein linked to Crohn's disease and celiac disease in humans. We now find that mice expressing point mutations in A20's M1 ubiquitin binding motif (ZF7) spontaneously develop proximate enteritis that requires both luminal microbes and T cells. Cellular and transcriptomic profiling reveal expansion of TH17/22 cells and aberrant expression of IL-17A and IL-22 in intestinal lamina propria of A20</span><sup>ZF7</sup><span><span> </span>mice. While deletion of IL-17A from A20</span><sup>ZF7/ZF7</sup><span><span> </span>mice exacerbates enteritis, deletion of IL-22 abrogates intestinal epithelial cell hyperproliferation, barrier dysfunction, and alarmin expression. A20</span><sup>ZF7/ZF7</sup><span><span> </span>TH17/22 cells autonomously express more RORγt and IL-22 after differentiation in vitro. ATAC sequencing identified an enhancer region upstream of the<span> </span></span><em>Il22</em><span><span> </span>gene in A20</span><sup>ZF7/ZF7</sup><span><span> </span>T cells, and this enhancer demonstrated increased activating histone acetylation coupled with exaggerated<span> </span></span><em>Il22</em><span><span> </span>transcription. Finally, CRISPR/Cas9-mediated ablation of A20</span><sup>ZF7</sup><span><span> </span>in human T cells increases RORγt expression and<span> </span></span><em>IL22</em><span><span> </span>transcription. These studies link A20's M1 ubiquitin binding function with RORγt expression, epigenetic activation of TH17/22 cells, and IL-22 driven enteritis.</span></p>',
'date' => '2025-01-02',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.12.31.630926v1',
'doi' => 'https://doi.org/10.1101/2024.12.31.630926',
'modified' => '2025-01-06 11:53:07',
'created' => '2025-01-06 11:53:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 7 => array(
'id' => '5051',
'name' => 'Gene mobility elements mediate cell type specific genome organization and radial gene movement in vivo',
'authors' => 'Tanguy Lucas et al.',
'description' => '<p><span>Understanding the level of genome organization that governs gene regulation remains a challenge despite advancements in chromatin profiling techniques. Cell type specific chromatin architectures may be obscured by averaging heterogeneous cell populations. Here we took a reductionist perspective, starting with the relocation of the </span><em>hunchback</em><span><span> </span>gene to the nuclear lamina in<span> </span></span><em>Drosophila</em><span><span> </span>neuroblasts. We previously found that this event terminates competence to produce early-born neurons and is mediated by an intronic 250 base-pair element, which we term gene mobility element (GME). Here we found over 800 putative GMEs globally that are chromatin accessible and are Polycomb (PcG) target sites. GMEs appear to be distinct from PcG response elements, however, which are largely chromatin inaccessible in neuroblasts. Performing<span> </span></span><em>in situ</em><span><span> </span>Hi-C of purified neuroblasts, we found that GMEs form megabase-scale chromatin interactions, spanning multiple topologically associated domain borders, preferentially contacting other GMEs. These interactions are cell type and stage-specific. Notably, GMEs undergo developmentally- timed mobilization to/from the neuroblast nuclear lamina, and domain swapping a GFP reporter transgene intron with a GME relocates the transgene to the nuclear lamina in embryos. We propose that GMEs constitute a genome organizational framework and mediate gene-to-lamina mobilization during progenitor competence state transitions<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-12-01',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.30.626181v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.30.626181',
'modified' => '2025-02-26 16:57:17',
'created' => '2025-02-26 16:57:17',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 8 => array(
'id' => '5002',
'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
'authors' => 'Michelle Lee Lynskey et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the α-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
'date' => '2024-11-26',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
'doi' => '10.1016/j.celrep.2024.114964',
'modified' => '2024-11-12 09:41:40',
'created' => '2024-11-12 09:41:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 9 => array(
'id' => '5052',
'name' => 'Steroid receptor-assisted loading modulates transcriptional responses in prostate cancer cells',
'authors' => 'Johannes Hiltunen et al.',
'description' => '<p><span>Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor (GR) is well-documented, where GR replaces antiandrogen-inactivated AR becoming the disease driver. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer have remained elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Intriguingly, pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</span></p>',
'date' => '2024-11-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.15.623719v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.15.623719',
'modified' => '2025-02-26 16:58:52',
'created' => '2025-02-26 16:58:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 10 => array(
'id' => '4996',
'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
'authors' => 'Akifumi Uota et al.',
'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific </span><em>Armc5</em><span><span> </span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span> </span></span><em>Scd1</em><span><span> </span>locus in the WAT of<span> </span></span><em>Armc5</em><span><span> </span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span> </span></span><em>Scd</em><span>. Mechanistically, disruption of<span> </span></span><em>Armc5</em><span><span> </span>restored decreased full-length SREBF1 in CHO cells deficient for<span> </span></span><em>Scap</em><span>. Overexpression of<span> </span></span><em>Scap</em><span><span> </span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span> </span></span><em>Armc5</em><span><span> </span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-11-02',
'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
'modified' => '2024-11-05 08:33:28',
'created' => '2024-11-05 08:33:28',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 11 => array(
'id' => '5055',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Felix Ezequiel Gerbaldo et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (a chromVAR-limma workflow with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs—in our case NFkB—at the protein level.</span></p>',
'date' => '2024-10-23',
'pmid' => 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1011971',
'doi' => 'https://doi.org/10.1371/journal.pcbi.1011971',
'modified' => '2025-02-26 17:05:52',
'created' => '2025-02-26 17:05:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 12 => array(
'id' => '4985',
'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
'authors' => 'Alessia Bagattin et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1β mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1β partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1β recruits TOP1 and induces DNA relaxation around bookmarked HNF1β sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1β mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1β (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that HNF1β remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1β-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1β and TOP1, where a mutation, found in “maturity onset diabetes of the young” patients, disrupts their interaction. Importantly, HNF1β recruits TOP1 and induces DNA relaxation around HNF1β mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1β reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
'date' => '2024-10-08',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
'doi' => '10.1016/j.celrep.2024.114805',
'modified' => '2024-10-14 09:04:44',
'created' => '2024-10-14 09:04:44',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 13 => array(
'id' => '4969',
'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
'authors' => 'Ghosh S. et al.',
'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
'date' => '2024-09-12',
'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
'modified' => '2024-09-16 09:43:31',
'created' => '2024-09-16 09:43:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 14 => array(
'id' => '4970',
'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
'authors' => 'van Dender C. et al. ',
'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPARα, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPARα downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4α, which has a strong impact on the expression of several important nuclear receptors, including PPARα. HNF4α depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4α agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4α is crucial in tolerance to sepsis. In conclusion, hepatic HNF4α activity is decreased during sepsis, causing PPARα downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
'date' => '2024-09-11',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
'doi' => '10.1038/s44321-024-00130-1',
'modified' => '2024-09-16 09:49:27',
'created' => '2024-09-16 09:49:27',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 15 => array(
'id' => '5053',
'name' => 'Peripheral nervous system mediates body-wide stem cell activation for limb regeneration',
'authors' => 'Duygu Payzin-Dogru et al.',
'description' => '<p><span>Many species throughout the animal kingdom naturally regenerate complex body parts following amputation. Most research in appendage regeneration has focused on identifying mechanisms that influence cell behaviors in the remaining stump tissue immediately adjacent to the injury site. Roles for activation steps that occur outside of the injury site remain largely unexplored, yet they may be critical for the regeneration process and may also shape the evolution of regeneration. Here, we discovered a role for the peripheral nervous system (PNS) in stimulating a body-wide stem cell activation response to amputation that drives limb regeneration. Notably, this systemic response is mediated by innervation at both the injury site and in distant, uninjured tissues, and by several signaling pathways, including adrenergic signaling. This work challenges the predominant conceptual framework considering the injury site alone in the regenerative response and argues instead for brain-body axis in stem cell activation as a priming step upon which molecular cues at the injury site then build tissue.</span></p>',
'date' => '2024-08-29',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2021.12.29.474455v3.abstract',
'doi' => 'https://doi.org/10.1101/2021.12.29.474455',
'modified' => '2025-02-26 17:00:21',
'created' => '2025-02-26 17:00:21',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 16 => array(
'id' => '5056',
'name' => 'Rhabdomyosarcoma fusion oncoprotein initially pioneers a neural signature in vivo',
'authors' => 'Jack Kucinski et al.',
'description' => '<p><span>Fusion-positive rhabdomyosarcoma is an aggressive pediatric cancer molecularly characterized by arrested myogenesis. The defining genetic driver, PAX3::FOXO1, functions as a chimeric gain-of-function transcription factor. An incomplete understanding of PAX3::FOXO1’s in vivo epigenetic mechanisms has hindered therapeutic development. Here, we establish a PAX3::FOXO1 zebrafish injection model and semi-automated ChIP-seq normalization strategy to evaluate how PAX3::FOXO1 initially interfaces with chromatin in a developmental context. We investigated PAX3::FOXO1’s recognition of chromatin and subsequent transcriptional consequences. We find that PAX3::FOXO1 interacts with inaccessible chromatin through partial/homeobox motif recognition consistent with pioneering activity. However, PAX3::FOXO1-genome binding through a composite paired-box/homeobox motif alters chromatin accessibility and redistributes H3K27ac to activate neural transcriptional programs. We uncover neural signatures that are highly representative of clinical rhabdomyosarcoma gene expression programs that are enriched following chemotherapy. Overall, we identify partial/homeobox motif recognition as a new mode for PAX3::FOXO1 pioneer function and identify neural signatures as a potentially critical PAX3::FOXO1 tumor initiation event.</span></p>',
'date' => '2024-07-16',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.07.12.603270v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.07.12.603270',
'modified' => '2025-02-26 17:07:24',
'created' => '2025-02-26 17:07:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 17 => array(
'id' => '5058',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Hanna Schwaemmle et al.',
'description' => '<p><span>The SWI/SNF (or BAF) complex is an essential chromatin remodeler that regulates DNA accessibility at developmental genes and enhancers. SWI/SNF subunits are among the most frequently mutated genes in cancer and neurodevelopmental disorders. These mutations are often heterozygous loss-of-function alleles, indicating a dosage-sensitive role for SWI/SNF subunits in chromatin regulation. However, the molecular mechanisms that regulate SWI/SNF subunit dosage to ensure proper complex assembly remain largely unexplored. We performed a genome-wide CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified </span><em>Mlf2</em><span><span> </span>and<span> </span></span><em>Rbm15</em><span><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, regulates a subset of SWI/SNF target genes by promoting chromatin remodeling activity. Next, we find that RBM15, part of the m</span><sup>6</sup><span>A RNA methylation writer complex, controls m</span><sup>6</sup><span>A modifications on specific SWI/SNF mRNAs to regulate protein levels of these subunits. Misregulation of m</span><sup>6</sup><span>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</span></p>',
'date' => '2024-06-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.06.25.600572v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.06.25.600572',
'modified' => '2025-02-26 17:10:53',
'created' => '2025-02-26 17:10:53',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 18 => array(
'id' => '5061',
'name' => 'Clock-dependent chromatin accessibility rhythms regulate circadian transcription',
'authors' => 'Ye Yuan et al.',
'description' => '<p><span>Chromatin organization plays a crucial role in gene regulation by controlling the accessibility of DNA to transcription machinery. While significant progress has been made in understanding the regulatory role of clock proteins in circadian rhythms, how chromatin organization affects circadian rhythms remains poorly understood. Here, we employed ATAC-seq (Assay for Transposase-Accessible Chromatin with Sequencing) on FAC-sorted Drosophila clock neurons to assess genome-wide chromatin accessibility at dawn and dusk over the circadian cycle. We observed significant oscillations in chromatin accessibility at promoter and enhancer regions of hundreds of genes, with enhanced accessibility either at dusk or dawn, which correlated with their peak transcriptional activity. Notably, genes with enhanced accessibility at dusk were enriched with E-box motifs, while those more accessible at dawn were enriched with VRI/PDP1-box motifs, indicating that they are regulated by the core circadian feedback loops, PER/CLK and VRI/PDP1, respectively. Further, we observed a complete loss of chromatin accessibility rhythms in </span><em>per</em><sup><em>01</em></sup><span><span> </span>null mutants, with chromatin consistently accessible at both dawn and dusk, underscoring the critical role of Period protein in driving chromatin compaction during the repression phase at dawn. Together, this study demonstrates the significant role of chromatin organization in circadian regulation, revealing how the interplay between clock proteins and chromatin structure orchestrates the precise timing of biological processes throughout the day. This work further implies that variations in chromatin accessibility might play a central role in the generation of diverse circadian gene expression patterns in clock neurons.</span></p>',
'date' => '2024-05-28',
'pmid' => 'https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011278',
'doi' => 'https://doi.org/10.1371/journal.pgen.1011278',
'modified' => '2025-02-26 17:21:25',
'created' => '2025-02-26 17:21:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 19 => array(
'id' => '5062',
'name' => 'PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites',
'authors' => 'Andrew Dimond et al.',
'description' => '<p><span>PBK/TOPK is a mitotic kinase implicated in haematological and non-haematological cancers. Here we show that the key haemopoietic regulators Ikaros and Aiolos require PBK-mediated phosphorylation to dissociate from chromosomes in mitosis. Eviction of Ikaros is rapidly reversed by addition of the PBK-inhibitor OTS514, revealing dynamic regulation by kinase and phosphatase activities. To identify more PBK targets, we analysed loss of mitotic phosphorylation events in </span><em>Pbk<sup>−/−</sup></em><span>preB cells and performed proteomic comparisons on isolated mitotic chromosomes. Among a large pool of C2H2-zinc finger targets, PBK is essential for evicting the CCCTC-binding protein CTCF and zinc finger proteins encoded by<span> </span></span><em>Ikzf1</em><span>,<span> </span></span><em>Ikzf3</em><span>,<span> </span></span><em>Znf131</em><span><span> </span>and<span> </span></span><em>Zbtb11</em><span>. PBK-deficient cells were able to divide but showed altered chromatin accessibility and nucleosome positioning consistent with CTCF retention. Our studies reveal that PBK controls the dissociation of selected factors from condensing mitotic chromosomes and contributes to their compaction.</span></p>',
'date' => '2024-04-23',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.23.590758v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.04.23.590758',
'modified' => '2025-02-26 17:22:58',
'created' => '2025-02-26 17:22:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 20 => array(
'id' => '5057',
'name' => 'Widespread impact of nucleosome remodelers on transcription at cis-regulatory elements',
'authors' => 'Benjamin J. Patty et al.',
'description' => '<p><span>Nucleosome remodeling complexes and other regulatory factors work in concert to build a chromatin environment that directs the expression of a distinct set of genes in each cell using cis-regulatory elements (CREs), such as promoters and enhancers, that drive transcription of both mRNAs and CRE-associated non-coding RNAs (ncRNAs). Two classes of CRE-associated ncRNAs include upstream antisense RNAs (uaRNAs), which are transcribed divergently from a shared mRNA promoter, and enhancer RNAs (eRNAs), which are transcribed bidirectionally from active enhancers. The complicated network of CRE regulation by nucleosome remodelers remains only partially explored, with a focus on a select, limited number of remodelers. We endeavored to elucidate a remodeler-based regulatory network governing CRE-associated transcription (mRNA, eRNA, and uaRNA) in murine embryonic stem (ES) cells to test the hypothesis that many SNF2-family nucleosome remodelers collaborate to regulate the coding and non-coding transcriptome via alteration of underlying nucleosome architecture. Using depletion followed by transient transcriptome sequencing (TT-seq), we identified thousands of misregulated mRNAs and CRE-associated ncRNAs across the remodelers examined, identifying novel contributions by understudied remodelers in the regulation of coding and non-coding transcription. Our findings suggest that mRNA and eRNA transcription are coordinately co-regulated, while mRNA and uaRNAs sharing a common promoter are independently regulated. Subsequent mechanistic studies suggest that while remodelers SRCAP and CHD8 modulate transcription through classical mechanisms such as transcription factors and histone variants, a broad set of remodelers including SMARCAL1 indirectly contribute to transcriptional regulation through maintenance of genomic stability and proper Integrator complex localization. This study systematically examines the contribution of SNF2-remodelers to the CRE-associated transcriptome, identifying at least two classes for remodeler action.</span></p>',
'date' => '2024-04-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.12.589208v1',
'doi' => 'https://doi.org/10.1101/2024.04.12.589208',
'modified' => '2025-02-26 17:09:18',
'created' => '2025-02-26 17:09:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 21 => array(
'id' => '4926',
'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
'authors' => 'Cobb L. et all.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (>3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
'date' => '2024-03-22',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
'doi' => '10.1371/journal.pone.0300865',
'modified' => '2024-03-25 11:15:06',
'created' => '2024-03-25 11:15:06',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 22 => array(
'id' => '5059',
'name' => 'EP300/CREBBP acetyltransferase inhibition limits steroid receptor and FOXA1 signaling in prostate cancer cells',
'authors' => 'Jasmin Huttunen et al.',
'description' => '<p><span>The androgen receptor (AR) is a primary target for treating prostate cancer (PCa), forming the bedrock of its clinical management. Despite their efficacy, resistance often hampers AR-targeted therapies, necessitating new strategies against therapy-resistant PCa. These resistances involve various mechanisms, including AR splice variant overexpression and altered activities of transcription factors like the glucocorticoid receptor (GR) and FOXA1. These factors rely on common coregulators, such as EP300/CREBBP, suggesting a rationale for coregulator-targeted therapies. Our study explores EP300/CREBBP acetyltransferase inhibition’s impact on steroid receptor and FOXA1 signaling in PCa cells using genome-wide techniques. Results reveal that EP300/CREBBP inhibition significantly disrupts the AR-regulated transcriptome and receptor chromatin binding by reducing the AR-gene expression. Similarly, GR’s regulated transcriptome and receptor binding were hindered, not linked to reduced GR expression but to diminished FOXA1 chromatin binding, restricting GR signaling. Overall, our findings highlight how EP300/CREBBP inhibition distinctively curtails oncogenic transcription factors’ signaling, suggesting the potential of coregulatory-targeted therapies in PCa.</span></p>',
'date' => '2024-03-13',
'pmid' => 'https://link.springer.com/article/10.1007/s00018-024-05209-z',
'doi' => 'https://doi.org/10.1007/s00018-024-05209-z',
'modified' => '2025-02-26 17:12:18',
'created' => '2025-02-26 17:12:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 23 => array(
'id' => '4923',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Gerbaldo F. et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs – in our case NFkB – at the protein level.</span></p>',
'date' => '2024-03-10',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
'modified' => '2024-03-13 17:04:33',
'created' => '2024-03-13 17:04:33',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 24 => array(
'id' => '4918',
'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
'authors' => 'Katsuda T.',
'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
'date' => '2024-02-26',
'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
'modified' => '2024-02-29 11:59:10',
'created' => '2024-02-29 11:59:10',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 25 => array(
'id' => '5003',
'name' => 'Improved metagenome assemblies through selective enrichment of bacterial genomic DNA from eukaryotic host genomic DNA using ATAC-seq',
'authors' => 'Lindsey J Cantin et al.',
'description' => '<p><span>Genomics can be used to study the complex relationships between hosts and their microbiota. Many bacteria cannot be cultured in the laboratory, making it difficult to obtain adequate amounts of bacterial DNA and to limit host DNA contamination for the construction of metagenome-assembled genomes (MAGs). For example, </span><em>Wolbachia</em><span><span> </span>is a genus of exclusively obligate intracellular bacteria that live in a wide range of arthropods and some nematodes. While<span> </span></span><em>Wolbachia</em><span><span> </span>endosymbionts are frequently described as facultative reproductive parasites in arthropods, the bacteria are obligate mutualistic endosymbionts of filarial worms. Here, we achieve 50-fold enrichment of bacterial sequences using ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) with<span> </span></span><em>Brugia malayi</em><span><span> </span>nematodes, containing<span> </span></span><em>Wolbachia</em><span><span> </span>(</span><em>w</em><span>Bm). ATAC-seq uses the Tn5 transposase to cut and attach Illumina sequencing adapters to accessible DNA lacking histones, typically thought to be open chromatin. Bacterial and mitochondrial DNA in the lysates are also cut preferentially since they lack histones, leading to the enrichment of these sequences. The benefits of this include minimal tissue input (<1 mg of tissue), a quick protocol (<4 h), low sequencing costs, less bias, correct assembly of lateral gene transfers and no prior sequence knowledge required. We assembled the<span> </span></span><em>w</em><span>Bm genome with as few as 1 million Illumina short paired-end reads with >97% coverage of the published genome, compared to only 12% coverage with the standard gDNA libraries. We found significant bacterial sequence enrichment that facilitated genome assembly in previously published ATAC-seq data sets from human cells infected with<span> </span></span><em>Mycobacterium tuberculosis</em><span><span> </span>and<span> </span></span><em>C. elegans</em><span><span> </span>contaminated with their food source, the OP50 strain of<span> </span></span><em>E. coli</em><span>. These results demonstrate the feasibility and benefits of using ATAC-seq to easily obtain bacterial genomes to aid in symbiosis, infectious disease, and microbiome research.</span></p>',
'date' => '2024-02-15',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC10902005/',
'doi' => '10.3389/fmicb.2024.1352378',
'modified' => '2024-11-29 11:10:24',
'created' => '2024-11-29 11:10:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 26 => array(
'id' => '4889',
'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
'authors' => 'Klein D.C. et al. ',
'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
'date' => '2023-12-21',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
'doi' => '10.1158/2767-9764.CRC-23-0382',
'modified' => '2024-01-02 11:07:14',
'created' => '2024-01-02 11:07:14',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 27 => array(
'id' => '5054',
'name' => 'Revisiting chromatin packaging in mouse sperm',
'authors' => 'Qiangzong Yin et al. ',
'description' => '',
'date' => '2023-12-21',
'pmid' => 'https://genome.cshlp.org/content/33/12/2079.short',
'doi' => 'https://www.genome.org/cgi/doi/10.1101/gr.277845.123',
'modified' => '2025-02-26 17:03:24',
'created' => '2025-02-26 17:03:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 28 => array(
'id' => '5063',
'name' => 'A fast and inexpensive plate-based NGS library preparation method for insect genomics',
'authors' => 'Lauren Cobb et al.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we investigate a fast and economical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs stored under different conditions. Using a standardised input of 6ng DNA, library preparation costs were significantly reduced through the 6-fold dilution of a commercially available tagmentation enzyme. Costs were further suppressed by direct post-amplification pooling, skipping quality assessment of individual libraries. We find that reduced DNA yields associated with ethanol-based storage do not impede overall sequencing success. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By lowering data generation costs, broadening the scope of whole genome studies to include low yield DNA extracts and increasing throughput, we expect this protocol to be of significant value for a range of applications in the field of insect genomics.</span></p>',
'date' => '2023-11-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.11.24.568434v1.abstract',
'doi' => 'https://doi.org/10.1101/2023.11.24.568434',
'modified' => '2025-02-26 17:24:46',
'created' => '2025-02-26 17:24:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 29 => array(
'id' => '5060',
'name' => 'Therapeutic targeting of EP300/CBP by bromodomain inhibition in hematologic malignancies',
'authors' => 'Luciano Nicosia et al. ',
'description' => '<p><span>CCS1477 (inobrodib) is a potent, selective EP300/CBP bromodomain inhibitor which induces cell-cycle arrest and differentiation in hematologic malignancy model systems. In myeloid leukemia cells, it promotes rapid eviction of EP300/CBP from an enhancer subset marked by strong MYB occupancy and high H3K27 acetylation, with downregulation of the subordinate oncogenic network and redistribution to sites close to differentiation genes. In myeloma cells, CCS1477 induces eviction of EP300/CBP from </span><i>FGFR3</i><span>, the target of the common (4; 14) translocation, with redistribution away from IRF4-occupied sites to TCF3/E2A-occupied sites. In a subset of patients with relapsed or refractory disease, CCS1477 monotherapy induces differentiation responses in AML and objective responses in heavily pre-treated multiple myeloma.<span> </span></span><i>In vivo</i><span><span> </span>preclinical combination studies reveal synergistic responses to treatment with standard-of-care agents. Thus, CCS1477 exhibits encouraging preclinical and early-phase clinical activity by disrupting recruitment of EP300/CBP to enhancer networks occupied by critical transcription factors.</span></p>',
'date' => '2023-11-22',
'pmid' => 'https://www.cell.com/cancer-cell/fulltext/S1535-6108(23)00366-5',
'doi' => '10.1016/j.ccell.2023.11.001',
'modified' => '2025-02-26 17:15:25',
'created' => '2025-02-26 17:15:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 30 => array(
'id' => '4878',
'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
'authors' => 'Menon D.U. et al.',
'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
'date' => '2023-09-28',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
'modified' => '2023-11-10 14:53:09',
'created' => '2023-11-10 14:53:09',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 31 => array(
'id' => '4825',
'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
'authors' => 'Miyazaki S. et al.',
'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
'date' => '2023-07-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
'doi' => '10.1038/s42003-023-05148-8',
'modified' => '2023-08-01 13:30:58',
'created' => '2023-08-01 15:59:38',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 32 => array(
'id' => '4817',
'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
'authors' => 'Yamazaki M. et al.',
'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
'date' => '2023-04-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
'doi' => '10.15252/embj.2022112614',
'modified' => '2023-06-15 10:06:12',
'created' => '2023-06-13 21:11:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 33 => array(
'id' => '4757',
'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
'authors' => 'Cittaro D. et al.',
'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10× Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et al. (2022) and de Pretis and Cittaro (2022)..</p>',
'date' => '2023-03-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
'doi' => '10.1016/j.xpro.2023.102176',
'modified' => '2023-04-17 09:04:55',
'created' => '2023-04-14 13:41:22',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 34 => array(
'id' => '4742',
'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
'authors' => 'Zou Han et al.',
'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled 1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue 2 (EZH2) and nuclear factor I X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
'date' => '2023-02-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
'doi' => '10.1038/s41556-023-01093-0',
'modified' => '2023-03-14 09:41:24',
'created' => '2023-03-02 17:27:08',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 35 => array(
'id' => '4568',
'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
'authors' => 'Katsuda T. et al.',
'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
'date' => '2023-01-01',
'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
'doi' => '10.1101/2023.02.14.528556',
'modified' => '2023-04-11 10:26:02',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 36 => array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
)
),
'Testimonial' => array(
(int) 0 => array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
[maximum depth reached]
)
)
),
'Area' => array(),
'SafetySheet' => array()
)
$meta_canonical = 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul'
$fromEmail = 'dev.diagenode.com'
$country = 'US'
$countries_allowed = array(
(int) 0 => 'CA',
(int) 1 => 'US',
(int) 2 => 'IE',
(int) 3 => 'GB',
(int) 4 => 'DK',
(int) 5 => 'NO',
(int) 6 => 'SE',
(int) 7 => 'FI',
(int) 8 => 'NL',
(int) 9 => 'BE',
(int) 10 => 'LU',
(int) 11 => 'FR',
(int) 12 => 'DE',
(int) 13 => 'CH',
(int) 14 => 'AT',
(int) 15 => 'ES',
(int) 16 => 'IT',
(int) 17 => 'PT'
)
$outsource = false
$other_formats = array(
(int) 0 => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
(int) 1 => array(
'id' => '3243',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '1,25 U / 10 µl ',
'catalog_number' => 'C01070013-10',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '120',
'price_USD' => '120',
'price_GBP' => '105',
'price_JPY' => '21600',
'price_CNY' => '',
'price_AUD' => '300',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-10ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 10 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 17:45:47',
'created' => '2025-05-22 15:14:17',
'ProductsGroup' => array(
'id' => '431',
'product_id' => '3243',
'group_id' => '368'
)
),
(int) 2 => array(
'id' => '3245',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '10 U / 80 µl',
'catalog_number' => 'C01070013-80',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '835',
'price_USD' => '835',
'price_GBP' => '715',
'price_JPY' => '150300',
'price_CNY' => '',
'price_AUD' => '2088',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-80ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 80 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:35',
'created' => '2025-05-27 23:38:24',
'ProductsGroup' => array(
'id' => '433',
'product_id' => '3245',
'group_id' => '368'
)
),
(int) 3 => array(
'id' => '3247',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '50 U / 400 µl',
'catalog_number' => 'C01070013-400',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '3200',
'price_USD' => '3200',
'price_GBP' => '2740',
'price_JPY' => '576000',
'price_CNY' => '',
'price_AUD' => '8000',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-400ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 400 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:07',
'created' => '2025-05-27 23:44:41',
'ProductsGroup' => array(
'id' => '435',
'product_id' => '3247',
'group_id' => '368'
)
),
(int) 4 => array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
)
$pro = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
'id' => '216',
'product_id' => '3244',
'testimonial_id' => '82'
)
)
$related_products = '<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011034</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011036</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3185" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3185" id="CartAdd/3185Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3185" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set II</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set2" data-reveal-id="cartModal-3185" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set II</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011037</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3206" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3206" id="CartAdd/3206Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3206" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set III</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set3" data-reveal-id="cartModal-3206" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set III</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/chipmentation-kit-for-histones"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011009</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3184" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3184" id="CartAdd/3184Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3184" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ChIPmentation Kit for Histones</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="chipmentation-kit-for-histones" data-reveal-id="cartModal-3184" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ChIPmentation Kit for Histones</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01080006</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ATAC-seq package for tissue</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01019043</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">Tagmentation Buffer (2x)</h6>
</div>
</div>
</li>
'
$related = array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
'id' => '5032',
'product_id' => '3244',
'related_id' => '3162'
),
'Image' => array(
(int) 0 => array(
'id' => '1776',
'name' => 'product/kits/kit-icon.png',
'alt' => 'Kit icon',
'modified' => '2019-04-09 12:06:37',
'created' => '2018-03-15 15:51:02',
'ProductsImage' => array(
[maximum depth reached]
)
)
)
)
$rrbs_service = array(
(int) 0 => (int) 1894,
(int) 1 => (int) 1895
)
$chipseq_service = array(
(int) 0 => (int) 2683,
(int) 1 => (int) 1835,
(int) 2 => (int) 1836,
(int) 3 => (int) 2684,
(int) 4 => (int) 1838,
(int) 5 => (int) 1839,
(int) 6 => (int) 1856
)
$labelize = object(Closure) {
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
'id' => '3322',
'product_id' => '3244',
'document_id' => '1191'
)
)
$publication = array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
'id' => '8387',
'product_id' => '3244',
'publication_id' => '4660'
)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'CustomErrorHandler::handleError() - APP/Lib/CustomErrorHandler.php, line 9
include - APP/View/Products/view.ctp, line 747
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1055
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118
(Notice): Undefined variable: message [APP/View/Products/view.ctp, line 747]Code Context $errorType = self::getErrorType($code);
self::logToDatabase( $errorType, $description, $file, $line);
return parent::handleError( $errorType, $description, $file, $line, $context);
$viewFile = '/var/www/dev.diagenode.com/app/View/Products/view.ctp'
$dataForView = array(
'language' => 'en',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'product' => array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
[maximum depth reached]
),
'Master' => array(
[maximum depth reached]
),
'Product' => array(
[maximum depth reached]
)
),
'Related' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
)
),
'Document' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
),
(int) 6 => array(
[maximum depth reached]
),
(int) 7 => array(
[maximum depth reached]
),
(int) 8 => array(
[maximum depth reached]
),
(int) 9 => array(
[maximum depth reached]
),
(int) 10 => array(
[maximum depth reached]
),
(int) 11 => array(
[maximum depth reached]
),
(int) 12 => array(
[maximum depth reached]
),
(int) 13 => array(
[maximum depth reached]
),
(int) 14 => array(
[maximum depth reached]
),
(int) 15 => array(
[maximum depth reached]
),
(int) 16 => array(
[maximum depth reached]
),
(int) 17 => array(
[maximum depth reached]
),
(int) 18 => array(
[maximum depth reached]
),
(int) 19 => array(
[maximum depth reached]
),
(int) 20 => array(
[maximum depth reached]
),
(int) 21 => array(
[maximum depth reached]
),
(int) 22 => array(
[maximum depth reached]
),
(int) 23 => array(
[maximum depth reached]
),
(int) 24 => array(
[maximum depth reached]
),
(int) 25 => array(
[maximum depth reached]
),
(int) 26 => array(
[maximum depth reached]
),
(int) 27 => array(
[maximum depth reached]
),
(int) 28 => array(
[maximum depth reached]
),
(int) 29 => array(
[maximum depth reached]
),
(int) 30 => array(
[maximum depth reached]
),
(int) 31 => array(
[maximum depth reached]
),
(int) 32 => array(
[maximum depth reached]
),
(int) 33 => array(
[maximum depth reached]
),
(int) 34 => array(
[maximum depth reached]
),
(int) 35 => array(
[maximum depth reached]
),
(int) 36 => array(
[maximum depth reached]
)
),
'Testimonial' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Area' => array(),
'SafetySheet' => array()
),
'meta_canonical' => 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul',
'fromEmail' => 'dev.diagenode.com'
)
$language = 'en'
$meta_keywords = ''
$meta_description = 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. '
$meta_title = 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode'
$product = array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
'id' => '368',
'name' => 'C01070013',
'product_id' => '3246',
'modified' => '2025-05-28 18:57:02',
'created' => '2025-05-27 23:47:46'
),
'Master' => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
'Product' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
)
)
),
'Related' => array(
(int) 0 => array(
'id' => '3158',
'antibody_id' => null,
'name' => '24 UDI for Tagmented libraries - Set I',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries – Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011034',
'old_catalog_number' => '',
'sf_code' => 'C01011034-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2024-05-15 10:25:12',
'created' => '2020-12-08 15:26:23',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '3185',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set II',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> <strong>24 UDI for tagmented libraries - Set II</strong><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<div id="info1" class="content active">
<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011036',
'old_catalog_number' => '',
'sf_code' => 'C01011036-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set2',
'meta_title' => '24 unique dual indexes for tagmented libraries set 2',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-01-09 19:07:24',
'created' => '2021-02-25 11:36:33',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '3206',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set III',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries </strong>includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation</a><a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns"> for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation</a><a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones"> Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2" target="_blank">24 UDI for tagmented libraries - Set II</a><br /> 24 UDI for tagmented libraries - Set III</p>
<p><br />Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries sets </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011037',
'old_catalog_number' => '',
'sf_code' => 'C01011037-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set3',
'meta_title' => '',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-04-06 12:02:03',
'created' => '2021-10-21 15:29:18',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 3 => array(
'id' => '3184',
'antibody_id' => null,
'name' => 'ChIPmentation Kit for Histones',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/chipmentation-for-histones-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ChIPmentation</b> is a method that combines <b>chromatin </b><b>immunoprecipiation</b> and <b>tagmentation</b><b>-based library preparation </b>using a fast and robust ChIP-seq protocol for studying <b>protein/DNA interactions</b>. In this method, following chromatin immunoprecipitation, the sequencing libraries are created directly on the chromatin-antibody-beads complex by the Tagmentase (Tn5 transposase) loaded with sequencing adapters. </p>
<p>The <b>ChIPmentation</b><b> Kit for Histones </b>includes all reagents for chromatin preparation, chromatin immunoprecipitation and library preparation using tagmentation. The <b>primer indexes </b>for multiplexing are <b>not included</b> in the kit and have to be purchase separately:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for </a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"> libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for </a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a> <a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for </a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"> libraries Cat. No. C01011032</a></li>
</ul>
<p><b>Benefits of the </b><b>ChIPmentation</b><b> system for histone </b><b>ChIP</b><b>-seq</b></p>
<ul>
<li>Easier and faster than classical ChIP-seq</li>
<li>Validated for various histone marks for a standard amount of cells</li>
<li>Generate high quality sequencing data</li>
</ul>
<p>For low input samples (10,000 cells) we recommend the <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">µChIPmentation kit for Histones</a>.</p>
<p>For ChIP-seq on transcription factors we recommend the <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">iDeal</a> <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">ChIP-seq</a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns"> for transcription </a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">factors</a> + <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a></p>',
'label1' => 'Validation',
'info1' => '<p>The Diagenode ChIPmentation technology has been tested on histone marks and compared to available datasets from the ENCODE project (Figure 1). ChIPmentation generated high quality data with low background. In addition, more than 99% of the top 40% peaks obtained with auto-ChIPmentation overlap with ENCODE datasets, which shows that ChIP-seq data obtained with ChIPmentation are highly reliable.</p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-1.png" /></p>
<div class="row">
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-2.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-3.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-4.png" /></div>
</div>
<p><small><b>Figure 1: </b><b>ChIPmentation</b> <b>sequencing</b> <b>results</b> <b>obtained</b> <b>from</b> <b>decreasing</b> <b>starting</b> <b>amounts</b><b> of </b><b>cells</b><b>.<br /> </b><br /> Chromatin preparation has been performed on 7 M K562 cells using the ChIPmentation Kit for Histones (Cat. no. C01011009) and 24 SI for ChIPmentation (Cat. No. C01011031). Diluted chromatin from 100.000, 10.000 and 5.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003). A. Distribution of the ChIPmentation readsets in a representative region of the genome. B., C. and D. Comparison of the top 40% peaks from 100.000 (B.), 10,000 (C.) and 5.000 (D.) cells with ENCODE dataset.</small></p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-5.png" /></p>
<p><small><b>Figure 2: </b><b>ChIPmentation</b><b> sequencing results.</b></small></p>
<p>Chromatin preparation has been performed on 7 M HeLa cells using the ChIPmentation Kit for Histones and 24 SI for ChIPmentation. Diluted chromatin from 100.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003) and H3K27me3 (Cat. no. C15410195) and IgG (Cat. no. C15410206).</p>',
'label2' => 'Additional solutions compatible with ChIPmentation Kit for Histones ',
'info2' => '<p><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">Chromatin shearing optimization kit - Low SDS (</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">iDeal</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells"> Kit for Histones)</a> optimizes chromatin shearing, a critical step for ChIP.</p>
<p><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">ChIP</a><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">-seq grade anti-histone antibodies</a> provide high yields with excellent specificity and sensitivity.</p>
<p>For fast and efficient isolation of magnetic beads we recommend the magnetic racks <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag0.2</a>.</p>
<p>Primer indexes for tagmenteted libraries:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><span> </span>libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a><span> </span><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"><span> </span>libraries Cat. No. C01011032</a></li>
</ul>
<p>The kit ChIPmentation for Histones is validated on the <a href="https://www.diagenode.com/en/categories/ip-star">IP-Star Compact System </a>and the corresponding protocol is included in the manual.</p>',
'label3' => '',
'info3' => '',
'format' => '4 chrom. prep./24 IPs',
'catalog_number' => 'C01011009',
'old_catalog_number' => '',
'sf_code' => 'C01011009-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '1865',
'price_USD' => '2235',
'price_GBP' => '1730',
'price_JPY' => '335700',
'price_CNY' => '',
'price_AUD' => '5588',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'chipmentation-kit-for-histones',
'meta_title' => 'ChIPmentation Kit for Histones',
'meta_keywords' => 'ChIPmentation Kit for Histones',
'meta_description' => 'ChIPmentation Kit for Histones',
'modified' => '2025-06-06 10:48:41',
'created' => '2021-01-28 10:29:40',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '3215',
'antibody_id' => null,
'name' => 'ATAC-seq package for tissue',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the <b>transposase Tn5</b> which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode’s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span> </span>Nuclei<span> </span>Extraction for ATAC-seq</a><span> </span>– optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span> </span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span> </span></a>– generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span>tagmented<span> </span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span> </span></a>– efficient multiplexing allowing for index hopping identification and filtering. </li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span> </span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" /> The project GENE-SWitCH leading to this application has received funding from the European Union’s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
'label1' => 'Method overview',
'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => 'Example of results',
'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode’s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork’s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => 'Additional solutions for ATAC-seq for tissue',
'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"> (Tn5 transposase) loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"> Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack: <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"> 0.2 ml – Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 rxns',
'catalog_number' => 'C01080006',
'old_catalog_number' => '',
'sf_code' => 'C01080006-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '2050',
'price_USD' => '2050',
'price_GBP' => '1765',
'price_JPY' => '369000',
'price_CNY' => '',
'price_AUD' => '5125',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'ATAC-seq-package-tissue-C01080006',
'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
'meta_keywords' => '',
'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
'modified' => '2023-04-06 11:06:44',
'created' => '2022-03-23 16:37:31',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 5 => array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
'id' => '3',
'position' => '4',
'parent_id' => null,
'name' => 'Kits',
'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode’s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg. </li>
</ul>
</div>
</div>',
'no_promo' => false,
'in_menu' => false,
'online' => true,
'tabular' => false,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'kits',
'cookies_tag_id' => null,
'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
'modified' => '2019-07-03 10:48:00',
'created' => '2014-11-13 22:28:36',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 1 => array(
'id' => '135',
'position' => '3',
'parent_id' => '15',
'name' => 'Library preparation for DNA sequencing',
'description' => '<p>Diagenode offers innovative DNA library preparation solutions such as a hyperactive tagmentase and the “capture and amplification by tailing and switching” (CATS), a ligation-free method to produce DNA libraries for next generation sequencing from low input amounts of DNA. Our powerfull ChIP-seq library preparation kits are also a great solution for low input DNA library preparation (discover our <a href="https://www.diagenode.com/en/categories/library-preparation-for-ChIP-seq">Diagenode MicroPlex family</a>). </p>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => true,
'all_format' => false,
'is_antibody' => false,
'slug' => 'library-preparation-for-dna-sequencing',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Library preparation for DNA sequencing | Diagenode',
'modified' => '2022-06-21 17:02:57',
'created' => '2018-03-22 09:34:18',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 2 => array(
'id' => '141',
'position' => '0',
'parent_id' => '86',
'name' => 'Tagmentation enzymes',
'description' => '',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'tagmentation-enzymes',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Tagmentation enzymes',
'modified' => '2020-03-24 17:49:07',
'created' => '2020-03-24 16:53:13',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
)
),
'Document' => array(
(int) 0 => array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
[maximum depth reached]
)
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
'id' => '1834',
'name' => 'https://www.diagenode.com/img/product/kits/tagmentation/StandardizedTagmentage-imgProduct.png',
'alt' => 'Standardized Tagmentase Product Image',
'modified' => '2025-05-28 17:01:35',
'created' => '2025-05-28 17:01:35',
'ProductsImage' => array(
[maximum depth reached]
)
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
'id' => '5151',
'name' => 'Quantitative measurement of phenotype dynamics during cancer drug resistance evolution using genetic barcoding',
'authors' => 'Whiting, F.J.H., Mossner, M., Gabbutt, C. et al. ',
'description' => '<section aria-labelledby="Abs1" data-title="Abstract" lang="en">
<div class="c-article-section" id="Abs1-section">
<div class="c-article-section__content" id="Abs1-content">
<p style="text-align: justify;">Cancer treatment frequently fails due to the evolution of drug-resistant cell phenotypes driven by genetic or non-genetic changes. The origin, timing, and rate of spread of these adaptations are critical for understanding drug resistance mechanisms but remain challenging to observe directly. We present a mathematical framework to infer drug resistance dynamics from genetic lineage tracing and population size data without direct measurement of resistance phenotypes. Simulation experiments demonstrate that the framework accurately recovers ground-truth evolutionary dynamics. Experimental evolution to 5-Fu chemotherapy in colorectal cancer cell lines SW620 and HCT116 validates the framework. In SW620 cells, a stable pre-existing resistant subpopulation was inferred, whereas in HCT116 cells, resistance emerged through phenotypic switching into a slow-growing resistant state with stochastic progression to full resistance. Functional assays, including scRNA-seq and scDNA-seq, validate these distinct evolutionary routes. This framework facilitates rapid characterisation of resistance mechanisms across diverse experimental settings.</p>
</div>
</div>
</section>',
'date' => '2025-06-20',
'pmid' => 'https://www.nature.com/articles/s41467-025-59479-7',
'doi' => 'https://doi.org/10.1038/s41467-025-59479-7',
'modified' => '2025-06-30 16:19:45',
'created' => '2025-06-30 16:19:45',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '5132',
'name' => 'Androgen receptor-mediated assisted loading of the glucocorticoid receptor modulates transcriptional responses in prostate cancer cells',
'authors' => 'Hiltunen, Johannes et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor NR3C1 (also known as GR) is well-documented, wherein AR suppression by antiandrogen therapy leads to elevated GR levels, enabling GR to compensate for and replace AR signaling. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer remain elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</p>
</div>
</div>',
'date' => '2025-06-02',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40456604/',
'doi' => '10.1101/gr.280224.124',
'modified' => '2025-06-06 15:50:05',
'created' => '2025-06-06 15:50:05',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '5133',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Schwaemmle, Hanna et al.',
'description' => '<p id="Par1" style="text-align: justify;">The SWI/SNF (or BAF) complex is an essential chromatin remodeler, which is frequently mutated in cancer and neurodevelopmental disorders. These are often heterozygous loss-of-function mutations, indicating a dosage-sensitive role for SWI/SNF subunits. However, the molecular mechanisms regulating SWI/SNF subunit dosage to ensure complex assembly remain largely unexplored. We performed a CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified<span> </span><em>Mlf2</em><span> </span>and<span> </span><em>Rbm15</em><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, promotes SWI/SNF assembly and binding to chromatin. Rapid degradation of MLF2 reduces chromatin accessibility at sites that depend on high levels of SWI/SNF binding to maintain open chromatin. Next, we find that RBM15, part of the m<sup>6</sup>A writer complex, controls m<sup>6</sup>A modifications on specific SWI/SNF mRNAs to regulate subunit protein levels. Misregulation of m<sup>6</sup>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</p>
<section id="kwd-group1" class="kwd-group"></section>',
'date' => '2025-05-30',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC12125367/',
'doi' => '10.1038/s41467-025-60424-x',
'modified' => '2025-06-06 15:53:40',
'created' => '2025-06-06 15:53:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 3 => array(
'id' => '5116',
'name' => 'Menin-MLL1 complex cooperates with NF-Y to promote HCC survival',
'authors' => 'Dzama-Karels, M., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-2" style="text-align: justify;">Identification of new therapeutic targets in hepatocellular carcinoma (HCC) remains critical. Chromatin regulating complexes are frequently mutated or aberrantly expressed in HCC, suggesting dysregulation of chromatin environments is a key feature driving liver cancer. To investigate whether the altered chromatin state in HCC cells could be targeted, we designed and utilized an epigenome-focused CRISPR library that targets genes involved in chromatin regulation. This focused approach allowed us to test multiple HCC cell lines in both 2D and 3D growth conditions, which revealed striking differences in the essentiality of genes involved in ubiquitination and multiple chromatin regulators vital for HCC cell survival in 2D but whose loss promoted growth in 3D. We found the core subunits of the menin-MLL1 complex among the strongest essential genes for HCC survival in all screens and thoroughly characterized the mechanism through which the menin-MLL1 complex promotes HCC cell growth. Inhibition of the menin-MLL1 interaction led to global changes in occupancy of the complex with concomitant decreases in H3K4me3 and expression of genes involved in PI3K/AKT/mTOR signaling pathway. Menin inhibition affected chromatin accessibility in HCC cells, revealing that increased chromatin accessibility at sites not bound by menin-MLL1 was associated with the recruitment of the pioneer transcription factor complex NF-Y. A CRISPR/Cas9 screen of chromatin regulators in the presence of menin inhibitor SNDX-5613 revealed a significantly increased cell death when combined with<span> </span><em>NFYB</em><span> </span>knockout. Together these data show that menin-MLL1 is necessary for HCC cell survival and cooperates with NF-Y to regulate oncogenic gene transcription.</p>',
'date' => '2025-04-08',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.04.05.647381v1',
'doi' => 'https://doi.org/10.1101/2025.04.05.647381',
'modified' => '2025-04-25 11:50:22',
'created' => '2025-04-25 11:45:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '5145',
'name' => 'Eosinophil innate immune memory after bacterial skin infection promotes allergic lung inflammation',
'authors' => 'Radhouani, Mariem et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Microbial exposure at barrier interfaces drives development and balance of the immune system, but the consequences of local infections for systemic immunity and secondary inflammation are unclear. Here, we show that skin exposure to the bacterium<span> </span><i>Staphylococcus aureus</i><span> </span>persistently shapes the immune system of mice with specific impact on progenitor and mature bone marrow neutrophil and eosinophil populations. The infection-imposed changes in eosinophils were long-lasting and associated with functional as well as imprinted epigenetic and metabolic changes. Bacterial exposure enhanced cutaneous allergic sensitization and resulted in exacerbated allergen-induced lung inflammation. Functional bone marrow eosinophil reprogramming and pulmonary allergen responses were driven by the alarmin interleukin-33 and the complement cleavage fragment C5a. Our study highlights the systemic impact of skin inflammation and reveals mechanisms of eosinophil innate immune memory and organ cross-talk that modulate systemic responses to allergens.</p>
</div>
</div>',
'date' => '2025-04-04',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40184438/',
'doi' => '10.1126/sciimmunol.adp6231',
'modified' => '2025-06-19 17:24:58',
'created' => '2025-06-19 17:24:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 5 => array(
'id' => '5115',
'name' => 'SIRT6 activator fucoidan extends healthspan and lifespan in aged wild-type mice',
'authors' => 'Biashad, S., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-4" style="text-align: justify;">SIRT6 is a protein deacylase, deacetylase, and mono-ADP-ribosylase (mADPr) regulating biological pathways important for longevity including DNA repair and silencing of LINE1 retrotransposons. SIRT6 knockout mice die by 30 days of age, whereas SIRT6 overexpression increases lifespan in male mice. Finding safe pharmacological activators of SIRT6 would have clinical benefits. Fucoidan, a polysaccharide purified from brown seaweed, has been identified as an activator of SIRT6 deacetylation activity. Here, we show that fucoidan also activates SIRT6 mADPr activity, which was shown to be elevated in certain human centenarians. Administering fucoidan to aged mice led to a significant increase in median lifespan in male mice. Both male and female mice demonstrated a marked reduction in frailty and epigenetic age. Fucoidan-treated mice showed repression of LINE1 elements suggesting that the beneficial effects of fucoidan are mediated, at least in part, by SIRT6. As brown seaweed rich in fucoidan is a popular food item in South Korea and Japan, countries with the highest life expectancy, we propose that fucoidan supplementation should be explored as a safe strategy for activating SIRT6 and improving human healthspan and lifespan.</p>',
'date' => '2025-03-26',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.03.24.645072v1',
'doi' => 'https://doi.org/10.1101/2025.03.24.645072',
'modified' => '2025-04-25 11:51:56',
'created' => '2025-04-25 11:42:49',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 6 => array(
'id' => '5018',
'name' => 'A20’s Linear Ubiquitin Binding Motif Restrains Pathogenic Activation of TH17/22 cells and IL-22 Driven Enteritis',
'authors' => 'Christopher John Bowman et al.',
'description' => '<p><span>A20, encoded by the </span><em>TNFAIP3</em><span><span> </span>gene, is a protein linked to Crohn's disease and celiac disease in humans. We now find that mice expressing point mutations in A20's M1 ubiquitin binding motif (ZF7) spontaneously develop proximate enteritis that requires both luminal microbes and T cells. Cellular and transcriptomic profiling reveal expansion of TH17/22 cells and aberrant expression of IL-17A and IL-22 in intestinal lamina propria of A20</span><sup>ZF7</sup><span><span> </span>mice. While deletion of IL-17A from A20</span><sup>ZF7/ZF7</sup><span><span> </span>mice exacerbates enteritis, deletion of IL-22 abrogates intestinal epithelial cell hyperproliferation, barrier dysfunction, and alarmin expression. A20</span><sup>ZF7/ZF7</sup><span><span> </span>TH17/22 cells autonomously express more RORγt and IL-22 after differentiation in vitro. ATAC sequencing identified an enhancer region upstream of the<span> </span></span><em>Il22</em><span><span> </span>gene in A20</span><sup>ZF7/ZF7</sup><span><span> </span>T cells, and this enhancer demonstrated increased activating histone acetylation coupled with exaggerated<span> </span></span><em>Il22</em><span><span> </span>transcription. Finally, CRISPR/Cas9-mediated ablation of A20</span><sup>ZF7</sup><span><span> </span>in human T cells increases RORγt expression and<span> </span></span><em>IL22</em><span><span> </span>transcription. These studies link A20's M1 ubiquitin binding function with RORγt expression, epigenetic activation of TH17/22 cells, and IL-22 driven enteritis.</span></p>',
'date' => '2025-01-02',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.12.31.630926v1',
'doi' => 'https://doi.org/10.1101/2024.12.31.630926',
'modified' => '2025-01-06 11:53:07',
'created' => '2025-01-06 11:53:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 7 => array(
'id' => '5051',
'name' => 'Gene mobility elements mediate cell type specific genome organization and radial gene movement in vivo',
'authors' => 'Tanguy Lucas et al.',
'description' => '<p><span>Understanding the level of genome organization that governs gene regulation remains a challenge despite advancements in chromatin profiling techniques. Cell type specific chromatin architectures may be obscured by averaging heterogeneous cell populations. Here we took a reductionist perspective, starting with the relocation of the </span><em>hunchback</em><span><span> </span>gene to the nuclear lamina in<span> </span></span><em>Drosophila</em><span><span> </span>neuroblasts. We previously found that this event terminates competence to produce early-born neurons and is mediated by an intronic 250 base-pair element, which we term gene mobility element (GME). Here we found over 800 putative GMEs globally that are chromatin accessible and are Polycomb (PcG) target sites. GMEs appear to be distinct from PcG response elements, however, which are largely chromatin inaccessible in neuroblasts. Performing<span> </span></span><em>in situ</em><span><span> </span>Hi-C of purified neuroblasts, we found that GMEs form megabase-scale chromatin interactions, spanning multiple topologically associated domain borders, preferentially contacting other GMEs. These interactions are cell type and stage-specific. Notably, GMEs undergo developmentally- timed mobilization to/from the neuroblast nuclear lamina, and domain swapping a GFP reporter transgene intron with a GME relocates the transgene to the nuclear lamina in embryos. We propose that GMEs constitute a genome organizational framework and mediate gene-to-lamina mobilization during progenitor competence state transitions<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-12-01',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.30.626181v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.30.626181',
'modified' => '2025-02-26 16:57:17',
'created' => '2025-02-26 16:57:17',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 8 => array(
'id' => '5002',
'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
'authors' => 'Michelle Lee Lynskey et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the α-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
'date' => '2024-11-26',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
'doi' => '10.1016/j.celrep.2024.114964',
'modified' => '2024-11-12 09:41:40',
'created' => '2024-11-12 09:41:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 9 => array(
'id' => '5052',
'name' => 'Steroid receptor-assisted loading modulates transcriptional responses in prostate cancer cells',
'authors' => 'Johannes Hiltunen et al.',
'description' => '<p><span>Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor (GR) is well-documented, where GR replaces antiandrogen-inactivated AR becoming the disease driver. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer have remained elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Intriguingly, pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</span></p>',
'date' => '2024-11-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.15.623719v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.15.623719',
'modified' => '2025-02-26 16:58:52',
'created' => '2025-02-26 16:58:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 10 => array(
'id' => '4996',
'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
'authors' => 'Akifumi Uota et al.',
'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific </span><em>Armc5</em><span><span> </span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span> </span></span><em>Scd1</em><span><span> </span>locus in the WAT of<span> </span></span><em>Armc5</em><span><span> </span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span> </span></span><em>Scd</em><span>. Mechanistically, disruption of<span> </span></span><em>Armc5</em><span><span> </span>restored decreased full-length SREBF1 in CHO cells deficient for<span> </span></span><em>Scap</em><span>. Overexpression of<span> </span></span><em>Scap</em><span><span> </span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span> </span></span><em>Armc5</em><span><span> </span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-11-02',
'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
'modified' => '2024-11-05 08:33:28',
'created' => '2024-11-05 08:33:28',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 11 => array(
'id' => '5055',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Felix Ezequiel Gerbaldo et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (a chromVAR-limma workflow with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs—in our case NFkB—at the protein level.</span></p>',
'date' => '2024-10-23',
'pmid' => 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1011971',
'doi' => 'https://doi.org/10.1371/journal.pcbi.1011971',
'modified' => '2025-02-26 17:05:52',
'created' => '2025-02-26 17:05:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 12 => array(
'id' => '4985',
'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
'authors' => 'Alessia Bagattin et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1β mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1β partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1β recruits TOP1 and induces DNA relaxation around bookmarked HNF1β sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1β mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1β (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that HNF1β remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1β-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1β and TOP1, where a mutation, found in “maturity onset diabetes of the young” patients, disrupts their interaction. Importantly, HNF1β recruits TOP1 and induces DNA relaxation around HNF1β mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1β reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
'date' => '2024-10-08',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
'doi' => '10.1016/j.celrep.2024.114805',
'modified' => '2024-10-14 09:04:44',
'created' => '2024-10-14 09:04:44',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 13 => array(
'id' => '4969',
'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
'authors' => 'Ghosh S. et al.',
'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
'date' => '2024-09-12',
'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
'modified' => '2024-09-16 09:43:31',
'created' => '2024-09-16 09:43:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 14 => array(
'id' => '4970',
'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
'authors' => 'van Dender C. et al. ',
'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPARα, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPARα downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4α, which has a strong impact on the expression of several important nuclear receptors, including PPARα. HNF4α depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4α agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4α is crucial in tolerance to sepsis. In conclusion, hepatic HNF4α activity is decreased during sepsis, causing PPARα downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
'date' => '2024-09-11',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
'doi' => '10.1038/s44321-024-00130-1',
'modified' => '2024-09-16 09:49:27',
'created' => '2024-09-16 09:49:27',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 15 => array(
'id' => '5053',
'name' => 'Peripheral nervous system mediates body-wide stem cell activation for limb regeneration',
'authors' => 'Duygu Payzin-Dogru et al.',
'description' => '<p><span>Many species throughout the animal kingdom naturally regenerate complex body parts following amputation. Most research in appendage regeneration has focused on identifying mechanisms that influence cell behaviors in the remaining stump tissue immediately adjacent to the injury site. Roles for activation steps that occur outside of the injury site remain largely unexplored, yet they may be critical for the regeneration process and may also shape the evolution of regeneration. Here, we discovered a role for the peripheral nervous system (PNS) in stimulating a body-wide stem cell activation response to amputation that drives limb regeneration. Notably, this systemic response is mediated by innervation at both the injury site and in distant, uninjured tissues, and by several signaling pathways, including adrenergic signaling. This work challenges the predominant conceptual framework considering the injury site alone in the regenerative response and argues instead for brain-body axis in stem cell activation as a priming step upon which molecular cues at the injury site then build tissue.</span></p>',
'date' => '2024-08-29',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2021.12.29.474455v3.abstract',
'doi' => 'https://doi.org/10.1101/2021.12.29.474455',
'modified' => '2025-02-26 17:00:21',
'created' => '2025-02-26 17:00:21',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 16 => array(
'id' => '5056',
'name' => 'Rhabdomyosarcoma fusion oncoprotein initially pioneers a neural signature in vivo',
'authors' => 'Jack Kucinski et al.',
'description' => '<p><span>Fusion-positive rhabdomyosarcoma is an aggressive pediatric cancer molecularly characterized by arrested myogenesis. The defining genetic driver, PAX3::FOXO1, functions as a chimeric gain-of-function transcription factor. An incomplete understanding of PAX3::FOXO1’s in vivo epigenetic mechanisms has hindered therapeutic development. Here, we establish a PAX3::FOXO1 zebrafish injection model and semi-automated ChIP-seq normalization strategy to evaluate how PAX3::FOXO1 initially interfaces with chromatin in a developmental context. We investigated PAX3::FOXO1’s recognition of chromatin and subsequent transcriptional consequences. We find that PAX3::FOXO1 interacts with inaccessible chromatin through partial/homeobox motif recognition consistent with pioneering activity. However, PAX3::FOXO1-genome binding through a composite paired-box/homeobox motif alters chromatin accessibility and redistributes H3K27ac to activate neural transcriptional programs. We uncover neural signatures that are highly representative of clinical rhabdomyosarcoma gene expression programs that are enriched following chemotherapy. Overall, we identify partial/homeobox motif recognition as a new mode for PAX3::FOXO1 pioneer function and identify neural signatures as a potentially critical PAX3::FOXO1 tumor initiation event.</span></p>',
'date' => '2024-07-16',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.07.12.603270v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.07.12.603270',
'modified' => '2025-02-26 17:07:24',
'created' => '2025-02-26 17:07:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 17 => array(
'id' => '5058',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Hanna Schwaemmle et al.',
'description' => '<p><span>The SWI/SNF (or BAF) complex is an essential chromatin remodeler that regulates DNA accessibility at developmental genes and enhancers. SWI/SNF subunits are among the most frequently mutated genes in cancer and neurodevelopmental disorders. These mutations are often heterozygous loss-of-function alleles, indicating a dosage-sensitive role for SWI/SNF subunits in chromatin regulation. However, the molecular mechanisms that regulate SWI/SNF subunit dosage to ensure proper complex assembly remain largely unexplored. We performed a genome-wide CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified </span><em>Mlf2</em><span><span> </span>and<span> </span></span><em>Rbm15</em><span><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, regulates a subset of SWI/SNF target genes by promoting chromatin remodeling activity. Next, we find that RBM15, part of the m</span><sup>6</sup><span>A RNA methylation writer complex, controls m</span><sup>6</sup><span>A modifications on specific SWI/SNF mRNAs to regulate protein levels of these subunits. Misregulation of m</span><sup>6</sup><span>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</span></p>',
'date' => '2024-06-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.06.25.600572v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.06.25.600572',
'modified' => '2025-02-26 17:10:53',
'created' => '2025-02-26 17:10:53',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 18 => array(
'id' => '5061',
'name' => 'Clock-dependent chromatin accessibility rhythms regulate circadian transcription',
'authors' => 'Ye Yuan et al.',
'description' => '<p><span>Chromatin organization plays a crucial role in gene regulation by controlling the accessibility of DNA to transcription machinery. While significant progress has been made in understanding the regulatory role of clock proteins in circadian rhythms, how chromatin organization affects circadian rhythms remains poorly understood. Here, we employed ATAC-seq (Assay for Transposase-Accessible Chromatin with Sequencing) on FAC-sorted Drosophila clock neurons to assess genome-wide chromatin accessibility at dawn and dusk over the circadian cycle. We observed significant oscillations in chromatin accessibility at promoter and enhancer regions of hundreds of genes, with enhanced accessibility either at dusk or dawn, which correlated with their peak transcriptional activity. Notably, genes with enhanced accessibility at dusk were enriched with E-box motifs, while those more accessible at dawn were enriched with VRI/PDP1-box motifs, indicating that they are regulated by the core circadian feedback loops, PER/CLK and VRI/PDP1, respectively. Further, we observed a complete loss of chromatin accessibility rhythms in </span><em>per</em><sup><em>01</em></sup><span><span> </span>null mutants, with chromatin consistently accessible at both dawn and dusk, underscoring the critical role of Period protein in driving chromatin compaction during the repression phase at dawn. Together, this study demonstrates the significant role of chromatin organization in circadian regulation, revealing how the interplay between clock proteins and chromatin structure orchestrates the precise timing of biological processes throughout the day. This work further implies that variations in chromatin accessibility might play a central role in the generation of diverse circadian gene expression patterns in clock neurons.</span></p>',
'date' => '2024-05-28',
'pmid' => 'https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011278',
'doi' => 'https://doi.org/10.1371/journal.pgen.1011278',
'modified' => '2025-02-26 17:21:25',
'created' => '2025-02-26 17:21:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 19 => array(
'id' => '5062',
'name' => 'PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites',
'authors' => 'Andrew Dimond et al.',
'description' => '<p><span>PBK/TOPK is a mitotic kinase implicated in haematological and non-haematological cancers. Here we show that the key haemopoietic regulators Ikaros and Aiolos require PBK-mediated phosphorylation to dissociate from chromosomes in mitosis. Eviction of Ikaros is rapidly reversed by addition of the PBK-inhibitor OTS514, revealing dynamic regulation by kinase and phosphatase activities. To identify more PBK targets, we analysed loss of mitotic phosphorylation events in </span><em>Pbk<sup>−/−</sup></em><span>preB cells and performed proteomic comparisons on isolated mitotic chromosomes. Among a large pool of C2H2-zinc finger targets, PBK is essential for evicting the CCCTC-binding protein CTCF and zinc finger proteins encoded by<span> </span></span><em>Ikzf1</em><span>,<span> </span></span><em>Ikzf3</em><span>,<span> </span></span><em>Znf131</em><span><span> </span>and<span> </span></span><em>Zbtb11</em><span>. PBK-deficient cells were able to divide but showed altered chromatin accessibility and nucleosome positioning consistent with CTCF retention. Our studies reveal that PBK controls the dissociation of selected factors from condensing mitotic chromosomes and contributes to their compaction.</span></p>',
'date' => '2024-04-23',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.23.590758v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.04.23.590758',
'modified' => '2025-02-26 17:22:58',
'created' => '2025-02-26 17:22:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 20 => array(
'id' => '5057',
'name' => 'Widespread impact of nucleosome remodelers on transcription at cis-regulatory elements',
'authors' => 'Benjamin J. Patty et al.',
'description' => '<p><span>Nucleosome remodeling complexes and other regulatory factors work in concert to build a chromatin environment that directs the expression of a distinct set of genes in each cell using cis-regulatory elements (CREs), such as promoters and enhancers, that drive transcription of both mRNAs and CRE-associated non-coding RNAs (ncRNAs). Two classes of CRE-associated ncRNAs include upstream antisense RNAs (uaRNAs), which are transcribed divergently from a shared mRNA promoter, and enhancer RNAs (eRNAs), which are transcribed bidirectionally from active enhancers. The complicated network of CRE regulation by nucleosome remodelers remains only partially explored, with a focus on a select, limited number of remodelers. We endeavored to elucidate a remodeler-based regulatory network governing CRE-associated transcription (mRNA, eRNA, and uaRNA) in murine embryonic stem (ES) cells to test the hypothesis that many SNF2-family nucleosome remodelers collaborate to regulate the coding and non-coding transcriptome via alteration of underlying nucleosome architecture. Using depletion followed by transient transcriptome sequencing (TT-seq), we identified thousands of misregulated mRNAs and CRE-associated ncRNAs across the remodelers examined, identifying novel contributions by understudied remodelers in the regulation of coding and non-coding transcription. Our findings suggest that mRNA and eRNA transcription are coordinately co-regulated, while mRNA and uaRNAs sharing a common promoter are independently regulated. Subsequent mechanistic studies suggest that while remodelers SRCAP and CHD8 modulate transcription through classical mechanisms such as transcription factors and histone variants, a broad set of remodelers including SMARCAL1 indirectly contribute to transcriptional regulation through maintenance of genomic stability and proper Integrator complex localization. This study systematically examines the contribution of SNF2-remodelers to the CRE-associated transcriptome, identifying at least two classes for remodeler action.</span></p>',
'date' => '2024-04-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.12.589208v1',
'doi' => 'https://doi.org/10.1101/2024.04.12.589208',
'modified' => '2025-02-26 17:09:18',
'created' => '2025-02-26 17:09:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 21 => array(
'id' => '4926',
'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
'authors' => 'Cobb L. et all.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (>3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
'date' => '2024-03-22',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
'doi' => '10.1371/journal.pone.0300865',
'modified' => '2024-03-25 11:15:06',
'created' => '2024-03-25 11:15:06',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 22 => array(
'id' => '5059',
'name' => 'EP300/CREBBP acetyltransferase inhibition limits steroid receptor and FOXA1 signaling in prostate cancer cells',
'authors' => 'Jasmin Huttunen et al.',
'description' => '<p><span>The androgen receptor (AR) is a primary target for treating prostate cancer (PCa), forming the bedrock of its clinical management. Despite their efficacy, resistance often hampers AR-targeted therapies, necessitating new strategies against therapy-resistant PCa. These resistances involve various mechanisms, including AR splice variant overexpression and altered activities of transcription factors like the glucocorticoid receptor (GR) and FOXA1. These factors rely on common coregulators, such as EP300/CREBBP, suggesting a rationale for coregulator-targeted therapies. Our study explores EP300/CREBBP acetyltransferase inhibition’s impact on steroid receptor and FOXA1 signaling in PCa cells using genome-wide techniques. Results reveal that EP300/CREBBP inhibition significantly disrupts the AR-regulated transcriptome and receptor chromatin binding by reducing the AR-gene expression. Similarly, GR’s regulated transcriptome and receptor binding were hindered, not linked to reduced GR expression but to diminished FOXA1 chromatin binding, restricting GR signaling. Overall, our findings highlight how EP300/CREBBP inhibition distinctively curtails oncogenic transcription factors’ signaling, suggesting the potential of coregulatory-targeted therapies in PCa.</span></p>',
'date' => '2024-03-13',
'pmid' => 'https://link.springer.com/article/10.1007/s00018-024-05209-z',
'doi' => 'https://doi.org/10.1007/s00018-024-05209-z',
'modified' => '2025-02-26 17:12:18',
'created' => '2025-02-26 17:12:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 23 => array(
'id' => '4923',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Gerbaldo F. et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs – in our case NFkB – at the protein level.</span></p>',
'date' => '2024-03-10',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
'modified' => '2024-03-13 17:04:33',
'created' => '2024-03-13 17:04:33',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 24 => array(
'id' => '4918',
'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
'authors' => 'Katsuda T.',
'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
'date' => '2024-02-26',
'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
'modified' => '2024-02-29 11:59:10',
'created' => '2024-02-29 11:59:10',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 25 => array(
'id' => '5003',
'name' => 'Improved metagenome assemblies through selective enrichment of bacterial genomic DNA from eukaryotic host genomic DNA using ATAC-seq',
'authors' => 'Lindsey J Cantin et al.',
'description' => '<p><span>Genomics can be used to study the complex relationships between hosts and their microbiota. Many bacteria cannot be cultured in the laboratory, making it difficult to obtain adequate amounts of bacterial DNA and to limit host DNA contamination for the construction of metagenome-assembled genomes (MAGs). For example, </span><em>Wolbachia</em><span><span> </span>is a genus of exclusively obligate intracellular bacteria that live in a wide range of arthropods and some nematodes. While<span> </span></span><em>Wolbachia</em><span><span> </span>endosymbionts are frequently described as facultative reproductive parasites in arthropods, the bacteria are obligate mutualistic endosymbionts of filarial worms. Here, we achieve 50-fold enrichment of bacterial sequences using ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) with<span> </span></span><em>Brugia malayi</em><span><span> </span>nematodes, containing<span> </span></span><em>Wolbachia</em><span><span> </span>(</span><em>w</em><span>Bm). ATAC-seq uses the Tn5 transposase to cut and attach Illumina sequencing adapters to accessible DNA lacking histones, typically thought to be open chromatin. Bacterial and mitochondrial DNA in the lysates are also cut preferentially since they lack histones, leading to the enrichment of these sequences. The benefits of this include minimal tissue input (<1 mg of tissue), a quick protocol (<4 h), low sequencing costs, less bias, correct assembly of lateral gene transfers and no prior sequence knowledge required. We assembled the<span> </span></span><em>w</em><span>Bm genome with as few as 1 million Illumina short paired-end reads with >97% coverage of the published genome, compared to only 12% coverage with the standard gDNA libraries. We found significant bacterial sequence enrichment that facilitated genome assembly in previously published ATAC-seq data sets from human cells infected with<span> </span></span><em>Mycobacterium tuberculosis</em><span><span> </span>and<span> </span></span><em>C. elegans</em><span><span> </span>contaminated with their food source, the OP50 strain of<span> </span></span><em>E. coli</em><span>. These results demonstrate the feasibility and benefits of using ATAC-seq to easily obtain bacterial genomes to aid in symbiosis, infectious disease, and microbiome research.</span></p>',
'date' => '2024-02-15',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC10902005/',
'doi' => '10.3389/fmicb.2024.1352378',
'modified' => '2024-11-29 11:10:24',
'created' => '2024-11-29 11:10:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 26 => array(
'id' => '4889',
'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
'authors' => 'Klein D.C. et al. ',
'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
'date' => '2023-12-21',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
'doi' => '10.1158/2767-9764.CRC-23-0382',
'modified' => '2024-01-02 11:07:14',
'created' => '2024-01-02 11:07:14',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 27 => array(
'id' => '5054',
'name' => 'Revisiting chromatin packaging in mouse sperm',
'authors' => 'Qiangzong Yin et al. ',
'description' => '',
'date' => '2023-12-21',
'pmid' => 'https://genome.cshlp.org/content/33/12/2079.short',
'doi' => 'https://www.genome.org/cgi/doi/10.1101/gr.277845.123',
'modified' => '2025-02-26 17:03:24',
'created' => '2025-02-26 17:03:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 28 => array(
'id' => '5063',
'name' => 'A fast and inexpensive plate-based NGS library preparation method for insect genomics',
'authors' => 'Lauren Cobb et al.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we investigate a fast and economical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs stored under different conditions. Using a standardised input of 6ng DNA, library preparation costs were significantly reduced through the 6-fold dilution of a commercially available tagmentation enzyme. Costs were further suppressed by direct post-amplification pooling, skipping quality assessment of individual libraries. We find that reduced DNA yields associated with ethanol-based storage do not impede overall sequencing success. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By lowering data generation costs, broadening the scope of whole genome studies to include low yield DNA extracts and increasing throughput, we expect this protocol to be of significant value for a range of applications in the field of insect genomics.</span></p>',
'date' => '2023-11-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.11.24.568434v1.abstract',
'doi' => 'https://doi.org/10.1101/2023.11.24.568434',
'modified' => '2025-02-26 17:24:46',
'created' => '2025-02-26 17:24:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 29 => array(
'id' => '5060',
'name' => 'Therapeutic targeting of EP300/CBP by bromodomain inhibition in hematologic malignancies',
'authors' => 'Luciano Nicosia et al. ',
'description' => '<p><span>CCS1477 (inobrodib) is a potent, selective EP300/CBP bromodomain inhibitor which induces cell-cycle arrest and differentiation in hematologic malignancy model systems. In myeloid leukemia cells, it promotes rapid eviction of EP300/CBP from an enhancer subset marked by strong MYB occupancy and high H3K27 acetylation, with downregulation of the subordinate oncogenic network and redistribution to sites close to differentiation genes. In myeloma cells, CCS1477 induces eviction of EP300/CBP from </span><i>FGFR3</i><span>, the target of the common (4; 14) translocation, with redistribution away from IRF4-occupied sites to TCF3/E2A-occupied sites. In a subset of patients with relapsed or refractory disease, CCS1477 monotherapy induces differentiation responses in AML and objective responses in heavily pre-treated multiple myeloma.<span> </span></span><i>In vivo</i><span><span> </span>preclinical combination studies reveal synergistic responses to treatment with standard-of-care agents. Thus, CCS1477 exhibits encouraging preclinical and early-phase clinical activity by disrupting recruitment of EP300/CBP to enhancer networks occupied by critical transcription factors.</span></p>',
'date' => '2023-11-22',
'pmid' => 'https://www.cell.com/cancer-cell/fulltext/S1535-6108(23)00366-5',
'doi' => '10.1016/j.ccell.2023.11.001',
'modified' => '2025-02-26 17:15:25',
'created' => '2025-02-26 17:15:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 30 => array(
'id' => '4878',
'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
'authors' => 'Menon D.U. et al.',
'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
'date' => '2023-09-28',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
'modified' => '2023-11-10 14:53:09',
'created' => '2023-11-10 14:53:09',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 31 => array(
'id' => '4825',
'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
'authors' => 'Miyazaki S. et al.',
'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
'date' => '2023-07-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
'doi' => '10.1038/s42003-023-05148-8',
'modified' => '2023-08-01 13:30:58',
'created' => '2023-08-01 15:59:38',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 32 => array(
'id' => '4817',
'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
'authors' => 'Yamazaki M. et al.',
'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
'date' => '2023-04-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
'doi' => '10.15252/embj.2022112614',
'modified' => '2023-06-15 10:06:12',
'created' => '2023-06-13 21:11:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 33 => array(
'id' => '4757',
'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
'authors' => 'Cittaro D. et al.',
'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10× Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et al. (2022) and de Pretis and Cittaro (2022)..</p>',
'date' => '2023-03-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
'doi' => '10.1016/j.xpro.2023.102176',
'modified' => '2023-04-17 09:04:55',
'created' => '2023-04-14 13:41:22',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 34 => array(
'id' => '4742',
'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
'authors' => 'Zou Han et al.',
'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled 1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue 2 (EZH2) and nuclear factor I X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
'date' => '2023-02-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
'doi' => '10.1038/s41556-023-01093-0',
'modified' => '2023-03-14 09:41:24',
'created' => '2023-03-02 17:27:08',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 35 => array(
'id' => '4568',
'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
'authors' => 'Katsuda T. et al.',
'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
'date' => '2023-01-01',
'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
'doi' => '10.1101/2023.02.14.528556',
'modified' => '2023-04-11 10:26:02',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 36 => array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
)
),
'Testimonial' => array(
(int) 0 => array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
[maximum depth reached]
)
)
),
'Area' => array(),
'SafetySheet' => array()
)
$meta_canonical = 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul'
$fromEmail = 'dev.diagenode.com'
$country = 'US'
$countries_allowed = array(
(int) 0 => 'CA',
(int) 1 => 'US',
(int) 2 => 'IE',
(int) 3 => 'GB',
(int) 4 => 'DK',
(int) 5 => 'NO',
(int) 6 => 'SE',
(int) 7 => 'FI',
(int) 8 => 'NL',
(int) 9 => 'BE',
(int) 10 => 'LU',
(int) 11 => 'FR',
(int) 12 => 'DE',
(int) 13 => 'CH',
(int) 14 => 'AT',
(int) 15 => 'ES',
(int) 16 => 'IT',
(int) 17 => 'PT'
)
$outsource = false
$other_formats = array(
(int) 0 => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
(int) 1 => array(
'id' => '3243',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '1,25 U / 10 µl ',
'catalog_number' => 'C01070013-10',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '120',
'price_USD' => '120',
'price_GBP' => '105',
'price_JPY' => '21600',
'price_CNY' => '',
'price_AUD' => '300',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-10ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 10 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 17:45:47',
'created' => '2025-05-22 15:14:17',
'ProductsGroup' => array(
'id' => '431',
'product_id' => '3243',
'group_id' => '368'
)
),
(int) 2 => array(
'id' => '3245',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '10 U / 80 µl',
'catalog_number' => 'C01070013-80',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '835',
'price_USD' => '835',
'price_GBP' => '715',
'price_JPY' => '150300',
'price_CNY' => '',
'price_AUD' => '2088',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-80ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 80 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:35',
'created' => '2025-05-27 23:38:24',
'ProductsGroup' => array(
'id' => '433',
'product_id' => '3245',
'group_id' => '368'
)
),
(int) 3 => array(
'id' => '3247',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '50 U / 400 µl',
'catalog_number' => 'C01070013-400',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '3200',
'price_USD' => '3200',
'price_GBP' => '2740',
'price_JPY' => '576000',
'price_CNY' => '',
'price_AUD' => '8000',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-400ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 400 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:07',
'created' => '2025-05-27 23:44:41',
'ProductsGroup' => array(
'id' => '435',
'product_id' => '3247',
'group_id' => '368'
)
),
(int) 4 => array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
)
$pro = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
'id' => '216',
'product_id' => '3244',
'testimonial_id' => '82'
)
)
$related_products = '<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011034</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011036</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3185" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3185" id="CartAdd/3185Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3185" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set II</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set2" data-reveal-id="cartModal-3185" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set II</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011037</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3206" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3206" id="CartAdd/3206Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3206" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set III</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set3" data-reveal-id="cartModal-3206" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set III</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/chipmentation-kit-for-histones"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011009</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3184" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3184" id="CartAdd/3184Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3184" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ChIPmentation Kit for Histones</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="chipmentation-kit-for-histones" data-reveal-id="cartModal-3184" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ChIPmentation Kit for Histones</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01080006</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ATAC-seq package for tissue</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01019043</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">Tagmentation Buffer (2x)</h6>
</div>
</div>
</li>
'
$related = array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
'id' => '5032',
'product_id' => '3244',
'related_id' => '3162'
),
'Image' => array(
(int) 0 => array(
'id' => '1776',
'name' => 'product/kits/kit-icon.png',
'alt' => 'Kit icon',
'modified' => '2019-04-09 12:06:37',
'created' => '2018-03-15 15:51:02',
'ProductsImage' => array(
[maximum depth reached]
)
)
)
)
$rrbs_service = array(
(int) 0 => (int) 1894,
(int) 1 => (int) 1895
)
$chipseq_service = array(
(int) 0 => (int) 2683,
(int) 1 => (int) 1835,
(int) 2 => (int) 1836,
(int) 3 => (int) 2684,
(int) 4 => (int) 1838,
(int) 5 => (int) 1839,
(int) 6 => (int) 1856
)
$labelize = object(Closure) {
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
'id' => '3322',
'product_id' => '3244',
'document_id' => '1191'
)
)
$publication = array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
'id' => '8387',
'product_id' => '3244',
'publication_id' => '4660'
)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'CustomErrorHandler::handleError() - APP/Lib/CustomErrorHandler.php, line 9
include - APP/View/Products/view.ctp, line 747
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1055
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118
(Notice): Undefined variable: campaign_id [APP/View/Products/view.ctp, line 747]Code Context $errorType = self::getErrorType($code);
self::logToDatabase( $errorType, $description, $file, $line);
return parent::handleError( $errorType, $description, $file, $line, $context);
$viewFile = '/var/www/dev.diagenode.com/app/View/Products/view.ctp'
$dataForView = array(
'language' => 'en',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'product' => array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
[maximum depth reached]
),
'Master' => array(
[maximum depth reached]
),
'Product' => array(
[maximum depth reached]
)
),
'Related' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
)
),
'Document' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
),
(int) 5 => array(
[maximum depth reached]
),
(int) 6 => array(
[maximum depth reached]
),
(int) 7 => array(
[maximum depth reached]
),
(int) 8 => array(
[maximum depth reached]
),
(int) 9 => array(
[maximum depth reached]
),
(int) 10 => array(
[maximum depth reached]
),
(int) 11 => array(
[maximum depth reached]
),
(int) 12 => array(
[maximum depth reached]
),
(int) 13 => array(
[maximum depth reached]
),
(int) 14 => array(
[maximum depth reached]
),
(int) 15 => array(
[maximum depth reached]
),
(int) 16 => array(
[maximum depth reached]
),
(int) 17 => array(
[maximum depth reached]
),
(int) 18 => array(
[maximum depth reached]
),
(int) 19 => array(
[maximum depth reached]
),
(int) 20 => array(
[maximum depth reached]
),
(int) 21 => array(
[maximum depth reached]
),
(int) 22 => array(
[maximum depth reached]
),
(int) 23 => array(
[maximum depth reached]
),
(int) 24 => array(
[maximum depth reached]
),
(int) 25 => array(
[maximum depth reached]
),
(int) 26 => array(
[maximum depth reached]
),
(int) 27 => array(
[maximum depth reached]
),
(int) 28 => array(
[maximum depth reached]
),
(int) 29 => array(
[maximum depth reached]
),
(int) 30 => array(
[maximum depth reached]
),
(int) 31 => array(
[maximum depth reached]
),
(int) 32 => array(
[maximum depth reached]
),
(int) 33 => array(
[maximum depth reached]
),
(int) 34 => array(
[maximum depth reached]
),
(int) 35 => array(
[maximum depth reached]
),
(int) 36 => array(
[maximum depth reached]
)
),
'Testimonial' => array(
(int) 0 => array(
[maximum depth reached]
)
),
'Area' => array(),
'SafetySheet' => array()
),
'meta_canonical' => 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul',
'fromEmail' => 'dev.diagenode.com'
)
$language = 'en'
$meta_keywords = ''
$meta_description = 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. '
$meta_title = 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode'
$product = array(
'Product' => array(
'id' => '3244',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '5 U / 40 µl',
'catalog_number' => 'C01070013-40',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '440',
'price_USD' => '440',
'price_GBP' => '380',
'price_JPY' => '79200',
'price_CNY' => '',
'price_AUD' => '1100',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-40ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 40 | Diagenode',
'meta_keywords' => '',
'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:02',
'created' => '2025-05-27 23:35:39',
'locale' => 'eng'
),
'Antibody' => array(
'host' => '*****',
'id' => null,
'name' => null,
'description' => null,
'clonality' => null,
'isotype' => null,
'lot' => null,
'concentration' => null,
'reactivity' => null,
'type' => null,
'purity' => null,
'classification' => null,
'application_table' => null,
'storage_conditions' => null,
'storage_buffer' => null,
'precautions' => null,
'uniprot_acc' => null,
'slug' => null,
'meta_keywords' => null,
'meta_description' => null,
'modified' => null,
'created' => null,
'select_label' => null
),
'Slave' => array(),
'Group' => array(
'Group' => array(
'id' => '368',
'name' => 'C01070013',
'product_id' => '3246',
'modified' => '2025-05-28 18:57:02',
'created' => '2025-05-27 23:47:46'
),
'Master' => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
'Product' => array(
(int) 0 => array(
[maximum depth reached]
),
(int) 1 => array(
[maximum depth reached]
),
(int) 2 => array(
[maximum depth reached]
),
(int) 3 => array(
[maximum depth reached]
),
(int) 4 => array(
[maximum depth reached]
)
)
),
'Related' => array(
(int) 0 => array(
'id' => '3158',
'antibody_id' => null,
'name' => '24 UDI for Tagmented libraries - Set I',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries – Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011034',
'old_catalog_number' => '',
'sf_code' => 'C01011034-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2024-05-15 10:25:12',
'created' => '2020-12-08 15:26:23',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '3185',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set II',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> <strong>24 UDI for tagmented libraries - Set II</strong><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<div id="info1" class="content active">
<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011036',
'old_catalog_number' => '',
'sf_code' => 'C01011036-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set2',
'meta_title' => '24 unique dual indexes for tagmented libraries set 2',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-01-09 19:07:24',
'created' => '2021-02-25 11:36:33',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '3206',
'antibody_id' => null,
'name' => '24 UDI for tagmented libraries - Set III',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries </strong>includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation</a><a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns"> for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation</a><a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones"> Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2" target="_blank">24 UDI for tagmented libraries - Set II</a><br /> 24 UDI for tagmented libraries - Set III</p>
<p><br />Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</p>
<p></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples </b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label1' => 'Characteristics',
'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries sets </b>are compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of µChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the µChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries – Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 UDI',
'catalog_number' => 'C01011037',
'old_catalog_number' => '',
'sf_code' => 'C01011037-',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '170',
'price_USD' => '190',
'price_GBP' => '160',
'price_JPY' => '30600',
'price_CNY' => '',
'price_AUD' => '475',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set3',
'meta_title' => '',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-04-06 12:02:03',
'created' => '2021-10-21 15:29:18',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 3 => array(
'id' => '3184',
'antibody_id' => null,
'name' => 'ChIPmentation Kit for Histones',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/chipmentation-for-histones-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ChIPmentation</b> is a method that combines <b>chromatin </b><b>immunoprecipiation</b> and <b>tagmentation</b><b>-based library preparation </b>using a fast and robust ChIP-seq protocol for studying <b>protein/DNA interactions</b>. In this method, following chromatin immunoprecipitation, the sequencing libraries are created directly on the chromatin-antibody-beads complex by the Tagmentase (Tn5 transposase) loaded with sequencing adapters. </p>
<p>The <b>ChIPmentation</b><b> Kit for Histones </b>includes all reagents for chromatin preparation, chromatin immunoprecipitation and library preparation using tagmentation. The <b>primer indexes </b>for multiplexing are <b>not included</b> in the kit and have to be purchase separately:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for </a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"> libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for </a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a> <a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for </a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"> libraries Cat. No. C01011032</a></li>
</ul>
<p><b>Benefits of the </b><b>ChIPmentation</b><b> system for histone </b><b>ChIP</b><b>-seq</b></p>
<ul>
<li>Easier and faster than classical ChIP-seq</li>
<li>Validated for various histone marks for a standard amount of cells</li>
<li>Generate high quality sequencing data</li>
</ul>
<p>For low input samples (10,000 cells) we recommend the <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">µChIPmentation kit for Histones</a>.</p>
<p>For ChIP-seq on transcription factors we recommend the <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">iDeal</a> <a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">ChIP-seq</a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns"> for transcription </a><a href="https://www.diagenode.com/en/p/ideal-chip-seq-kit-for-transcription-factors-x24-24-rxns">factors</a> + <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG kit for </a><a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">ChIPmentation</a></p>',
'label1' => 'Validation',
'info1' => '<p>The Diagenode ChIPmentation technology has been tested on histone marks and compared to available datasets from the ENCODE project (Figure 1). ChIPmentation generated high quality data with low background. In addition, more than 99% of the top 40% peaks obtained with auto-ChIPmentation overlap with ENCODE datasets, which shows that ChIP-seq data obtained with ChIPmentation are highly reliable.</p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-1.png" /></p>
<div class="row">
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-2.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-3.png" /></div>
<div class="small-4 medium-4 large-4 columns"><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-4.png" /></div>
</div>
<p><small><b>Figure 1: </b><b>ChIPmentation</b> <b>sequencing</b> <b>results</b> <b>obtained</b> <b>from</b> <b>decreasing</b> <b>starting</b> <b>amounts</b><b> of </b><b>cells</b><b>.<br /> </b><br /> Chromatin preparation has been performed on 7 M K562 cells using the ChIPmentation Kit for Histones (Cat. no. C01011009) and 24 SI for ChIPmentation (Cat. No. C01011031). Diluted chromatin from 100.000, 10.000 and 5.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003). A. Distribution of the ChIPmentation readsets in a representative region of the genome. B., C. and D. Comparison of the top 40% peaks from 100.000 (B.), 10,000 (C.) and 5.000 (D.) cells with ENCODE dataset.</small></p>
<p></p>
<p><img src="https://www.diagenode.com/img/product/kits/ChIPmentation-for-histone-5.png" /></p>
<p><small><b>Figure 2: </b><b>ChIPmentation</b><b> sequencing results.</b></small></p>
<p>Chromatin preparation has been performed on 7 M HeLa cells using the ChIPmentation Kit for Histones and 24 SI for ChIPmentation. Diluted chromatin from 100.000 cells was used for the immunoprecipitation with the Diagenode antibody targeting H3K4me3 (Cat. no. C15410003) and H3K27me3 (Cat. no. C15410195) and IgG (Cat. no. C15410206).</p>',
'label2' => 'Additional solutions compatible with ChIPmentation Kit for Histones ',
'info2' => '<p><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">Chromatin shearing optimization kit - Low SDS (</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells">iDeal</a><a href="https://www.diagenode.com/en/p/chromatin-shearing-optimization-kit-low-sds-100-million-cells"> Kit for Histones)</a> optimizes chromatin shearing, a critical step for ChIP.</p>
<p><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">ChIP</a><a href="https://www.diagenode.com/en/categories/chip-seq-grade-antibodies">-seq grade anti-histone antibodies</a> provide high yields with excellent specificity and sensitivity.</p>
<p>For fast and efficient isolation of magnetic beads we recommend the magnetic racks <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag0.2</a>.</p>
<p>Primer indexes for tagmenteted libraries:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">Tagmented</a><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><span> </span>libraries - Set I, Cat. No. C0101134</a></li>
<li><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">8 UDI for<span> </span></a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">Tagmented</a><span> </span><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">libraries</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries">, Cat. No. C0101135</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for Tagmented libraries - Set II, Cat. No. C0101136</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for Tagmented libraries - Set III, Cat. No. C0101137</a></li>
<li><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">24 SI for<span> </span></a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries">Tagmented</a><a href="https://www.diagenode.com/en/p/24-si-for-tagmented-libraries"><span> </span>libraries Cat. No. C01011032</a></li>
</ul>
<p>The kit ChIPmentation for Histones is validated on the <a href="https://www.diagenode.com/en/categories/ip-star">IP-Star Compact System </a>and the corresponding protocol is included in the manual.</p>',
'label3' => '',
'info3' => '',
'format' => '4 chrom. prep./24 IPs',
'catalog_number' => 'C01011009',
'old_catalog_number' => '',
'sf_code' => 'C01011009-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '1865',
'price_USD' => '2235',
'price_GBP' => '1730',
'price_JPY' => '335700',
'price_CNY' => '',
'price_AUD' => '5588',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'chipmentation-kit-for-histones',
'meta_title' => 'ChIPmentation Kit for Histones',
'meta_keywords' => 'ChIPmentation Kit for Histones',
'meta_description' => 'ChIPmentation Kit for Histones',
'modified' => '2025-06-06 10:48:41',
'created' => '2021-01-28 10:29:40',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '3215',
'antibody_id' => null,
'name' => 'ATAC-seq package for tissue',
'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the <b>transposase Tn5</b> which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode’s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span> </span>Nuclei<span> </span>Extraction for ATAC-seq</a><span> </span>– optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span> </span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span> </span></a>– generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for<span> </span>tagmented<span> </span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span> </span></a>– efficient multiplexing allowing for index hopping identification and filtering. </li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span> </span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" /> The project GENE-SWitCH leading to this application has received funding from the European Union’s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
'label1' => 'Method overview',
'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => 'Example of results',
'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode’s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork’s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => 'Additional solutions for ATAC-seq for tissue',
'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"> (Tn5 transposase) loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"> Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a> <a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack: <a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"> 0.2 ml – Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '24 rxns',
'catalog_number' => 'C01080006',
'old_catalog_number' => '',
'sf_code' => 'C01080006-',
'type' => 'RFR',
'search_order' => '',
'price_EUR' => '2050',
'price_USD' => '2050',
'price_GBP' => '1765',
'price_JPY' => '369000',
'price_CNY' => '',
'price_AUD' => '5125',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'ATAC-seq-package-tissue-C01080006',
'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
'meta_keywords' => '',
'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
'modified' => '2023-04-06 11:06:44',
'created' => '2022-03-23 16:37:31',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array([maximum depth reached])
),
(int) 5 => array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
[maximum depth reached]
),
'Image' => array(
[maximum depth reached]
)
)
),
'Application' => array(),
'Category' => array(
(int) 0 => array(
'id' => '3',
'position' => '4',
'parent_id' => null,
'name' => 'Kits',
'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode’s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg. </li>
</ul>
</div>
</div>',
'no_promo' => false,
'in_menu' => false,
'online' => true,
'tabular' => false,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'kits',
'cookies_tag_id' => null,
'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
'modified' => '2019-07-03 10:48:00',
'created' => '2014-11-13 22:28:36',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 1 => array(
'id' => '135',
'position' => '3',
'parent_id' => '15',
'name' => 'Library preparation for DNA sequencing',
'description' => '<p>Diagenode offers innovative DNA library preparation solutions such as a hyperactive tagmentase and the “capture and amplification by tailing and switching” (CATS), a ligation-free method to produce DNA libraries for next generation sequencing from low input amounts of DNA. Our powerfull ChIP-seq library preparation kits are also a great solution for low input DNA library preparation (discover our <a href="https://www.diagenode.com/en/categories/library-preparation-for-ChIP-seq">Diagenode MicroPlex family</a>). </p>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>
<div id="ConnectiveDocSignExtentionInstalled" data-extension-version="1.0.4"></div>',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => true,
'all_format' => false,
'is_antibody' => false,
'slug' => 'library-preparation-for-dna-sequencing',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Library preparation for DNA sequencing | Diagenode',
'modified' => '2022-06-21 17:02:57',
'created' => '2018-03-22 09:34:18',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
),
(int) 2 => array(
'id' => '141',
'position' => '0',
'parent_id' => '86',
'name' => 'Tagmentation enzymes',
'description' => '',
'no_promo' => false,
'in_menu' => true,
'online' => true,
'tabular' => true,
'hide' => false,
'all_format' => false,
'is_antibody' => false,
'slug' => 'tagmentation-enzymes',
'cookies_tag_id' => null,
'meta_keywords' => '',
'meta_description' => '',
'meta_title' => 'Tagmentation enzymes',
'modified' => '2020-03-24 17:49:07',
'created' => '2020-03-24 16:53:13',
'ProductsCategory' => array(
[maximum depth reached]
),
'CookiesTag' => array([maximum depth reached])
)
),
'Document' => array(
(int) 0 => array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
[maximum depth reached]
)
)
),
'Feature' => array(),
'Image' => array(
(int) 0 => array(
'id' => '1834',
'name' => 'https://www.diagenode.com/img/product/kits/tagmentation/StandardizedTagmentage-imgProduct.png',
'alt' => 'Standardized Tagmentase Product Image',
'modified' => '2025-05-28 17:01:35',
'created' => '2025-05-28 17:01:35',
'ProductsImage' => array(
[maximum depth reached]
)
)
),
'Promotion' => array(),
'Protocol' => array(),
'Publication' => array(
(int) 0 => array(
'id' => '5151',
'name' => 'Quantitative measurement of phenotype dynamics during cancer drug resistance evolution using genetic barcoding',
'authors' => 'Whiting, F.J.H., Mossner, M., Gabbutt, C. et al. ',
'description' => '<section aria-labelledby="Abs1" data-title="Abstract" lang="en">
<div class="c-article-section" id="Abs1-section">
<div class="c-article-section__content" id="Abs1-content">
<p style="text-align: justify;">Cancer treatment frequently fails due to the evolution of drug-resistant cell phenotypes driven by genetic or non-genetic changes. The origin, timing, and rate of spread of these adaptations are critical for understanding drug resistance mechanisms but remain challenging to observe directly. We present a mathematical framework to infer drug resistance dynamics from genetic lineage tracing and population size data without direct measurement of resistance phenotypes. Simulation experiments demonstrate that the framework accurately recovers ground-truth evolutionary dynamics. Experimental evolution to 5-Fu chemotherapy in colorectal cancer cell lines SW620 and HCT116 validates the framework. In SW620 cells, a stable pre-existing resistant subpopulation was inferred, whereas in HCT116 cells, resistance emerged through phenotypic switching into a slow-growing resistant state with stochastic progression to full resistance. Functional assays, including scRNA-seq and scDNA-seq, validate these distinct evolutionary routes. This framework facilitates rapid characterisation of resistance mechanisms across diverse experimental settings.</p>
</div>
</div>
</section>',
'date' => '2025-06-20',
'pmid' => 'https://www.nature.com/articles/s41467-025-59479-7',
'doi' => 'https://doi.org/10.1038/s41467-025-59479-7',
'modified' => '2025-06-30 16:19:45',
'created' => '2025-06-30 16:19:45',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 1 => array(
'id' => '5132',
'name' => 'Androgen receptor-mediated assisted loading of the glucocorticoid receptor modulates transcriptional responses in prostate cancer cells',
'authors' => 'Hiltunen, Johannes et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor NR3C1 (also known as GR) is well-documented, wherein AR suppression by antiandrogen therapy leads to elevated GR levels, enabling GR to compensate for and replace AR signaling. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer remain elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</p>
</div>
</div>',
'date' => '2025-06-02',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40456604/',
'doi' => '10.1101/gr.280224.124',
'modified' => '2025-06-06 15:50:05',
'created' => '2025-06-06 15:50:05',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 2 => array(
'id' => '5133',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Schwaemmle, Hanna et al.',
'description' => '<p id="Par1" style="text-align: justify;">The SWI/SNF (or BAF) complex is an essential chromatin remodeler, which is frequently mutated in cancer and neurodevelopmental disorders. These are often heterozygous loss-of-function mutations, indicating a dosage-sensitive role for SWI/SNF subunits. However, the molecular mechanisms regulating SWI/SNF subunit dosage to ensure complex assembly remain largely unexplored. We performed a CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified<span> </span><em>Mlf2</em><span> </span>and<span> </span><em>Rbm15</em><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, promotes SWI/SNF assembly and binding to chromatin. Rapid degradation of MLF2 reduces chromatin accessibility at sites that depend on high levels of SWI/SNF binding to maintain open chromatin. Next, we find that RBM15, part of the m<sup>6</sup>A writer complex, controls m<sup>6</sup>A modifications on specific SWI/SNF mRNAs to regulate subunit protein levels. Misregulation of m<sup>6</sup>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</p>
<section id="kwd-group1" class="kwd-group"></section>',
'date' => '2025-05-30',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC12125367/',
'doi' => '10.1038/s41467-025-60424-x',
'modified' => '2025-06-06 15:53:40',
'created' => '2025-06-06 15:53:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 3 => array(
'id' => '5116',
'name' => 'Menin-MLL1 complex cooperates with NF-Y to promote HCC survival',
'authors' => 'Dzama-Karels, M., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-2" style="text-align: justify;">Identification of new therapeutic targets in hepatocellular carcinoma (HCC) remains critical. Chromatin regulating complexes are frequently mutated or aberrantly expressed in HCC, suggesting dysregulation of chromatin environments is a key feature driving liver cancer. To investigate whether the altered chromatin state in HCC cells could be targeted, we designed and utilized an epigenome-focused CRISPR library that targets genes involved in chromatin regulation. This focused approach allowed us to test multiple HCC cell lines in both 2D and 3D growth conditions, which revealed striking differences in the essentiality of genes involved in ubiquitination and multiple chromatin regulators vital for HCC cell survival in 2D but whose loss promoted growth in 3D. We found the core subunits of the menin-MLL1 complex among the strongest essential genes for HCC survival in all screens and thoroughly characterized the mechanism through which the menin-MLL1 complex promotes HCC cell growth. Inhibition of the menin-MLL1 interaction led to global changes in occupancy of the complex with concomitant decreases in H3K4me3 and expression of genes involved in PI3K/AKT/mTOR signaling pathway. Menin inhibition affected chromatin accessibility in HCC cells, revealing that increased chromatin accessibility at sites not bound by menin-MLL1 was associated with the recruitment of the pioneer transcription factor complex NF-Y. A CRISPR/Cas9 screen of chromatin regulators in the presence of menin inhibitor SNDX-5613 revealed a significantly increased cell death when combined with<span> </span><em>NFYB</em><span> </span>knockout. Together these data show that menin-MLL1 is necessary for HCC cell survival and cooperates with NF-Y to regulate oncogenic gene transcription.</p>',
'date' => '2025-04-08',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.04.05.647381v1',
'doi' => 'https://doi.org/10.1101/2025.04.05.647381',
'modified' => '2025-04-25 11:50:22',
'created' => '2025-04-25 11:45:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 4 => array(
'id' => '5145',
'name' => 'Eosinophil innate immune memory after bacterial skin infection promotes allergic lung inflammation',
'authors' => 'Radhouani, Mariem et al.',
'description' => '<div class="abstract" id="abstract">
<div class="abstract-content selected" id="eng-abstract">
<p style="text-align: justify;">Microbial exposure at barrier interfaces drives development and balance of the immune system, but the consequences of local infections for systemic immunity and secondary inflammation are unclear. Here, we show that skin exposure to the bacterium<span> </span><i>Staphylococcus aureus</i><span> </span>persistently shapes the immune system of mice with specific impact on progenitor and mature bone marrow neutrophil and eosinophil populations. The infection-imposed changes in eosinophils were long-lasting and associated with functional as well as imprinted epigenetic and metabolic changes. Bacterial exposure enhanced cutaneous allergic sensitization and resulted in exacerbated allergen-induced lung inflammation. Functional bone marrow eosinophil reprogramming and pulmonary allergen responses were driven by the alarmin interleukin-33 and the complement cleavage fragment C5a. Our study highlights the systemic impact of skin inflammation and reveals mechanisms of eosinophil innate immune memory and organ cross-talk that modulate systemic responses to allergens.</p>
</div>
</div>',
'date' => '2025-04-04',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/40184438/',
'doi' => '10.1126/sciimmunol.adp6231',
'modified' => '2025-06-19 17:24:58',
'created' => '2025-06-19 17:24:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 5 => array(
'id' => '5115',
'name' => 'SIRT6 activator fucoidan extends healthspan and lifespan in aged wild-type mice',
'authors' => 'Biashad, S., et al.',
'description' => '<p><strong>Abstract</strong></p>
<p id="p-4" style="text-align: justify;">SIRT6 is a protein deacylase, deacetylase, and mono-ADP-ribosylase (mADPr) regulating biological pathways important for longevity including DNA repair and silencing of LINE1 retrotransposons. SIRT6 knockout mice die by 30 days of age, whereas SIRT6 overexpression increases lifespan in male mice. Finding safe pharmacological activators of SIRT6 would have clinical benefits. Fucoidan, a polysaccharide purified from brown seaweed, has been identified as an activator of SIRT6 deacetylation activity. Here, we show that fucoidan also activates SIRT6 mADPr activity, which was shown to be elevated in certain human centenarians. Administering fucoidan to aged mice led to a significant increase in median lifespan in male mice. Both male and female mice demonstrated a marked reduction in frailty and epigenetic age. Fucoidan-treated mice showed repression of LINE1 elements suggesting that the beneficial effects of fucoidan are mediated, at least in part, by SIRT6. As brown seaweed rich in fucoidan is a popular food item in South Korea and Japan, countries with the highest life expectancy, we propose that fucoidan supplementation should be explored as a safe strategy for activating SIRT6 and improving human healthspan and lifespan.</p>',
'date' => '2025-03-26',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2025.03.24.645072v1',
'doi' => 'https://doi.org/10.1101/2025.03.24.645072',
'modified' => '2025-04-25 11:51:56',
'created' => '2025-04-25 11:42:49',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 6 => array(
'id' => '5018',
'name' => 'A20’s Linear Ubiquitin Binding Motif Restrains Pathogenic Activation of TH17/22 cells and IL-22 Driven Enteritis',
'authors' => 'Christopher John Bowman et al.',
'description' => '<p><span>A20, encoded by the </span><em>TNFAIP3</em><span><span> </span>gene, is a protein linked to Crohn's disease and celiac disease in humans. We now find that mice expressing point mutations in A20's M1 ubiquitin binding motif (ZF7) spontaneously develop proximate enteritis that requires both luminal microbes and T cells. Cellular and transcriptomic profiling reveal expansion of TH17/22 cells and aberrant expression of IL-17A and IL-22 in intestinal lamina propria of A20</span><sup>ZF7</sup><span><span> </span>mice. While deletion of IL-17A from A20</span><sup>ZF7/ZF7</sup><span><span> </span>mice exacerbates enteritis, deletion of IL-22 abrogates intestinal epithelial cell hyperproliferation, barrier dysfunction, and alarmin expression. A20</span><sup>ZF7/ZF7</sup><span><span> </span>TH17/22 cells autonomously express more RORγt and IL-22 after differentiation in vitro. ATAC sequencing identified an enhancer region upstream of the<span> </span></span><em>Il22</em><span><span> </span>gene in A20</span><sup>ZF7/ZF7</sup><span><span> </span>T cells, and this enhancer demonstrated increased activating histone acetylation coupled with exaggerated<span> </span></span><em>Il22</em><span><span> </span>transcription. Finally, CRISPR/Cas9-mediated ablation of A20</span><sup>ZF7</sup><span><span> </span>in human T cells increases RORγt expression and<span> </span></span><em>IL22</em><span><span> </span>transcription. These studies link A20's M1 ubiquitin binding function with RORγt expression, epigenetic activation of TH17/22 cells, and IL-22 driven enteritis.</span></p>',
'date' => '2025-01-02',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.12.31.630926v1',
'doi' => 'https://doi.org/10.1101/2024.12.31.630926',
'modified' => '2025-01-06 11:53:07',
'created' => '2025-01-06 11:53:07',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 7 => array(
'id' => '5051',
'name' => 'Gene mobility elements mediate cell type specific genome organization and radial gene movement in vivo',
'authors' => 'Tanguy Lucas et al.',
'description' => '<p><span>Understanding the level of genome organization that governs gene regulation remains a challenge despite advancements in chromatin profiling techniques. Cell type specific chromatin architectures may be obscured by averaging heterogeneous cell populations. Here we took a reductionist perspective, starting with the relocation of the </span><em>hunchback</em><span><span> </span>gene to the nuclear lamina in<span> </span></span><em>Drosophila</em><span><span> </span>neuroblasts. We previously found that this event terminates competence to produce early-born neurons and is mediated by an intronic 250 base-pair element, which we term gene mobility element (GME). Here we found over 800 putative GMEs globally that are chromatin accessible and are Polycomb (PcG) target sites. GMEs appear to be distinct from PcG response elements, however, which are largely chromatin inaccessible in neuroblasts. Performing<span> </span></span><em>in situ</em><span><span> </span>Hi-C of purified neuroblasts, we found that GMEs form megabase-scale chromatin interactions, spanning multiple topologically associated domain borders, preferentially contacting other GMEs. These interactions are cell type and stage-specific. Notably, GMEs undergo developmentally- timed mobilization to/from the neuroblast nuclear lamina, and domain swapping a GFP reporter transgene intron with a GME relocates the transgene to the nuclear lamina in embryos. We propose that GMEs constitute a genome organizational framework and mediate gene-to-lamina mobilization during progenitor competence state transitions<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-12-01',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.30.626181v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.30.626181',
'modified' => '2025-02-26 16:57:17',
'created' => '2025-02-26 16:57:17',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 8 => array(
'id' => '5002',
'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
'authors' => 'Michelle Lee Lynskey et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the α-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
'date' => '2024-11-26',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
'doi' => '10.1016/j.celrep.2024.114964',
'modified' => '2024-11-12 09:41:40',
'created' => '2024-11-12 09:41:40',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 9 => array(
'id' => '5052',
'name' => 'Steroid receptor-assisted loading modulates transcriptional responses in prostate cancer cells',
'authors' => 'Johannes Hiltunen et al.',
'description' => '<p><span>Steroid receptors are involved in a wide array of crosstalk mechanisms that regulate diverse biological processes, with significant implications in diseases, particularly in cancers. In prostate cancer, indirect crosstalk between androgen receptor (AR) and glucocorticoid receptor (GR) is well-documented, where GR replaces antiandrogen-inactivated AR becoming the disease driver. However, the existence and impact of direct chromatin crosstalk between AR and GR in prostate cancer have remained elusive. Our genome-wide investigations reveal that AR activation significantly expands GR chromatin binding. Mechanistically, AR induces remodeling of closed chromatin sites, facilitating GR binding to inaccessible sites. Importantly, coactivation of AR and GR results in distinct transcriptional responses at both the cell population and single-cell levels. Intriguingly, pathways affected by these transcriptional changes are generally associated with improved patient survival. Thus, the direct crosstalk between AR and GR yields markedly different outcomes from the known role of GR in circumventing AR blockade by antiandrogens.</span></p>',
'date' => '2024-11-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.11.15.623719v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.11.15.623719',
'modified' => '2025-02-26 16:58:52',
'created' => '2025-02-26 16:58:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 10 => array(
'id' => '4996',
'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
'authors' => 'Akifumi Uota et al.',
'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific </span><em>Armc5</em><span><span> </span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span> </span></span><em>Scd1</em><span><span> </span>locus in the WAT of<span> </span></span><em>Armc5</em><span><span> </span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span> </span></span><em>Scd</em><span>. Mechanistically, disruption of<span> </span></span><em>Armc5</em><span><span> </span>restored decreased full-length SREBF1 in CHO cells deficient for<span> </span></span><em>Scap</em><span>. Overexpression of<span> </span></span><em>Scap</em><span><span> </span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span> </span></span><em>Armc5</em><span><span> </span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span> </span></span><em>in vivo</em><span>.</span></p>',
'date' => '2024-11-02',
'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
'modified' => '2024-11-05 08:33:28',
'created' => '2024-11-05 08:33:28',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 11 => array(
'id' => '5055',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Felix Ezequiel Gerbaldo et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (a chromVAR-limma workflow with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs—in our case NFkB—at the protein level.</span></p>',
'date' => '2024-10-23',
'pmid' => 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1011971',
'doi' => 'https://doi.org/10.1371/journal.pcbi.1011971',
'modified' => '2025-02-26 17:05:52',
'created' => '2025-02-26 17:05:52',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 12 => array(
'id' => '4985',
'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
'authors' => 'Alessia Bagattin et al.',
'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1β mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1β partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1β recruits TOP1 and induces DNA relaxation around bookmarked HNF1β sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1β mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1β (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that HNF1β remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1β-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1β and TOP1, where a mutation, found in “maturity onset diabetes of the young” patients, disrupts their interaction. Importantly, HNF1β recruits TOP1 and induces DNA relaxation around HNF1β mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1β reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
'date' => '2024-10-08',
'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
'doi' => '10.1016/j.celrep.2024.114805',
'modified' => '2024-10-14 09:04:44',
'created' => '2024-10-14 09:04:44',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 13 => array(
'id' => '4969',
'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
'authors' => 'Ghosh S. et al.',
'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
'date' => '2024-09-12',
'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
'modified' => '2024-09-16 09:43:31',
'created' => '2024-09-16 09:43:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 14 => array(
'id' => '4970',
'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
'authors' => 'van Dender C. et al. ',
'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPARα, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPARα downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4α, which has a strong impact on the expression of several important nuclear receptors, including PPARα. HNF4α depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4α agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4α is crucial in tolerance to sepsis. In conclusion, hepatic HNF4α activity is decreased during sepsis, causing PPARα downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
'date' => '2024-09-11',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
'doi' => '10.1038/s44321-024-00130-1',
'modified' => '2024-09-16 09:49:27',
'created' => '2024-09-16 09:49:27',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 15 => array(
'id' => '5053',
'name' => 'Peripheral nervous system mediates body-wide stem cell activation for limb regeneration',
'authors' => 'Duygu Payzin-Dogru et al.',
'description' => '<p><span>Many species throughout the animal kingdom naturally regenerate complex body parts following amputation. Most research in appendage regeneration has focused on identifying mechanisms that influence cell behaviors in the remaining stump tissue immediately adjacent to the injury site. Roles for activation steps that occur outside of the injury site remain largely unexplored, yet they may be critical for the regeneration process and may also shape the evolution of regeneration. Here, we discovered a role for the peripheral nervous system (PNS) in stimulating a body-wide stem cell activation response to amputation that drives limb regeneration. Notably, this systemic response is mediated by innervation at both the injury site and in distant, uninjured tissues, and by several signaling pathways, including adrenergic signaling. This work challenges the predominant conceptual framework considering the injury site alone in the regenerative response and argues instead for brain-body axis in stem cell activation as a priming step upon which molecular cues at the injury site then build tissue.</span></p>',
'date' => '2024-08-29',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2021.12.29.474455v3.abstract',
'doi' => 'https://doi.org/10.1101/2021.12.29.474455',
'modified' => '2025-02-26 17:00:21',
'created' => '2025-02-26 17:00:21',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 16 => array(
'id' => '5056',
'name' => 'Rhabdomyosarcoma fusion oncoprotein initially pioneers a neural signature in vivo',
'authors' => 'Jack Kucinski et al.',
'description' => '<p><span>Fusion-positive rhabdomyosarcoma is an aggressive pediatric cancer molecularly characterized by arrested myogenesis. The defining genetic driver, PAX3::FOXO1, functions as a chimeric gain-of-function transcription factor. An incomplete understanding of PAX3::FOXO1’s in vivo epigenetic mechanisms has hindered therapeutic development. Here, we establish a PAX3::FOXO1 zebrafish injection model and semi-automated ChIP-seq normalization strategy to evaluate how PAX3::FOXO1 initially interfaces with chromatin in a developmental context. We investigated PAX3::FOXO1’s recognition of chromatin and subsequent transcriptional consequences. We find that PAX3::FOXO1 interacts with inaccessible chromatin through partial/homeobox motif recognition consistent with pioneering activity. However, PAX3::FOXO1-genome binding through a composite paired-box/homeobox motif alters chromatin accessibility and redistributes H3K27ac to activate neural transcriptional programs. We uncover neural signatures that are highly representative of clinical rhabdomyosarcoma gene expression programs that are enriched following chemotherapy. Overall, we identify partial/homeobox motif recognition as a new mode for PAX3::FOXO1 pioneer function and identify neural signatures as a potentially critical PAX3::FOXO1 tumor initiation event.</span></p>',
'date' => '2024-07-16',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.07.12.603270v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.07.12.603270',
'modified' => '2025-02-26 17:07:24',
'created' => '2025-02-26 17:07:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 17 => array(
'id' => '5058',
'name' => 'CRISPR screen decodes SWI/SNF chromatin remodeling complex assembly',
'authors' => 'Hanna Schwaemmle et al.',
'description' => '<p><span>The SWI/SNF (or BAF) complex is an essential chromatin remodeler that regulates DNA accessibility at developmental genes and enhancers. SWI/SNF subunits are among the most frequently mutated genes in cancer and neurodevelopmental disorders. These mutations are often heterozygous loss-of-function alleles, indicating a dosage-sensitive role for SWI/SNF subunits in chromatin regulation. However, the molecular mechanisms that regulate SWI/SNF subunit dosage to ensure proper complex assembly remain largely unexplored. We performed a genome-wide CRISPR KO screen, using epigenome editing in mouse embryonic stem cells, and identified </span><em>Mlf2</em><span><span> </span>and<span> </span></span><em>Rbm15</em><span><span> </span>as regulators of SWI/SNF complex activity. First, we show that MLF2, a poorly characterized chaperone protein, regulates a subset of SWI/SNF target genes by promoting chromatin remodeling activity. Next, we find that RBM15, part of the m</span><sup>6</sup><span>A RNA methylation writer complex, controls m</span><sup>6</sup><span>A modifications on specific SWI/SNF mRNAs to regulate protein levels of these subunits. Misregulation of m</span><sup>6</sup><span>A methylation causes overexpression of core SWI/SNF subunits leading to the assembly of incomplete complexes lacking the catalytic ATPase/ARP subunits. These data indicate that targeting modulators of SWI/SNF complex assembly may offer a potent therapeutic strategy for diseases associated with impaired chromatin remodeling.</span></p>',
'date' => '2024-06-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.06.25.600572v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.06.25.600572',
'modified' => '2025-02-26 17:10:53',
'created' => '2025-02-26 17:10:53',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 18 => array(
'id' => '5061',
'name' => 'Clock-dependent chromatin accessibility rhythms regulate circadian transcription',
'authors' => 'Ye Yuan et al.',
'description' => '<p><span>Chromatin organization plays a crucial role in gene regulation by controlling the accessibility of DNA to transcription machinery. While significant progress has been made in understanding the regulatory role of clock proteins in circadian rhythms, how chromatin organization affects circadian rhythms remains poorly understood. Here, we employed ATAC-seq (Assay for Transposase-Accessible Chromatin with Sequencing) on FAC-sorted Drosophila clock neurons to assess genome-wide chromatin accessibility at dawn and dusk over the circadian cycle. We observed significant oscillations in chromatin accessibility at promoter and enhancer regions of hundreds of genes, with enhanced accessibility either at dusk or dawn, which correlated with their peak transcriptional activity. Notably, genes with enhanced accessibility at dusk were enriched with E-box motifs, while those more accessible at dawn were enriched with VRI/PDP1-box motifs, indicating that they are regulated by the core circadian feedback loops, PER/CLK and VRI/PDP1, respectively. Further, we observed a complete loss of chromatin accessibility rhythms in </span><em>per</em><sup><em>01</em></sup><span><span> </span>null mutants, with chromatin consistently accessible at both dawn and dusk, underscoring the critical role of Period protein in driving chromatin compaction during the repression phase at dawn. Together, this study demonstrates the significant role of chromatin organization in circadian regulation, revealing how the interplay between clock proteins and chromatin structure orchestrates the precise timing of biological processes throughout the day. This work further implies that variations in chromatin accessibility might play a central role in the generation of diverse circadian gene expression patterns in clock neurons.</span></p>',
'date' => '2024-05-28',
'pmid' => 'https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011278',
'doi' => 'https://doi.org/10.1371/journal.pgen.1011278',
'modified' => '2025-02-26 17:21:25',
'created' => '2025-02-26 17:21:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 19 => array(
'id' => '5062',
'name' => 'PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sites',
'authors' => 'Andrew Dimond et al.',
'description' => '<p><span>PBK/TOPK is a mitotic kinase implicated in haematological and non-haematological cancers. Here we show that the key haemopoietic regulators Ikaros and Aiolos require PBK-mediated phosphorylation to dissociate from chromosomes in mitosis. Eviction of Ikaros is rapidly reversed by addition of the PBK-inhibitor OTS514, revealing dynamic regulation by kinase and phosphatase activities. To identify more PBK targets, we analysed loss of mitotic phosphorylation events in </span><em>Pbk<sup>−/−</sup></em><span>preB cells and performed proteomic comparisons on isolated mitotic chromosomes. Among a large pool of C2H2-zinc finger targets, PBK is essential for evicting the CCCTC-binding protein CTCF and zinc finger proteins encoded by<span> </span></span><em>Ikzf1</em><span>,<span> </span></span><em>Ikzf3</em><span>,<span> </span></span><em>Znf131</em><span><span> </span>and<span> </span></span><em>Zbtb11</em><span>. PBK-deficient cells were able to divide but showed altered chromatin accessibility and nucleosome positioning consistent with CTCF retention. Our studies reveal that PBK controls the dissociation of selected factors from condensing mitotic chromosomes and contributes to their compaction.</span></p>',
'date' => '2024-04-23',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.23.590758v1.abstract',
'doi' => 'https://doi.org/10.1101/2024.04.23.590758',
'modified' => '2025-02-26 17:22:58',
'created' => '2025-02-26 17:22:58',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 20 => array(
'id' => '5057',
'name' => 'Widespread impact of nucleosome remodelers on transcription at cis-regulatory elements',
'authors' => 'Benjamin J. Patty et al.',
'description' => '<p><span>Nucleosome remodeling complexes and other regulatory factors work in concert to build a chromatin environment that directs the expression of a distinct set of genes in each cell using cis-regulatory elements (CREs), such as promoters and enhancers, that drive transcription of both mRNAs and CRE-associated non-coding RNAs (ncRNAs). Two classes of CRE-associated ncRNAs include upstream antisense RNAs (uaRNAs), which are transcribed divergently from a shared mRNA promoter, and enhancer RNAs (eRNAs), which are transcribed bidirectionally from active enhancers. The complicated network of CRE regulation by nucleosome remodelers remains only partially explored, with a focus on a select, limited number of remodelers. We endeavored to elucidate a remodeler-based regulatory network governing CRE-associated transcription (mRNA, eRNA, and uaRNA) in murine embryonic stem (ES) cells to test the hypothesis that many SNF2-family nucleosome remodelers collaborate to regulate the coding and non-coding transcriptome via alteration of underlying nucleosome architecture. Using depletion followed by transient transcriptome sequencing (TT-seq), we identified thousands of misregulated mRNAs and CRE-associated ncRNAs across the remodelers examined, identifying novel contributions by understudied remodelers in the regulation of coding and non-coding transcription. Our findings suggest that mRNA and eRNA transcription are coordinately co-regulated, while mRNA and uaRNAs sharing a common promoter are independently regulated. Subsequent mechanistic studies suggest that while remodelers SRCAP and CHD8 modulate transcription through classical mechanisms such as transcription factors and histone variants, a broad set of remodelers including SMARCAL1 indirectly contribute to transcriptional regulation through maintenance of genomic stability and proper Integrator complex localization. This study systematically examines the contribution of SNF2-remodelers to the CRE-associated transcriptome, identifying at least two classes for remodeler action.</span></p>',
'date' => '2024-04-15',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.04.12.589208v1',
'doi' => 'https://doi.org/10.1101/2024.04.12.589208',
'modified' => '2025-02-26 17:09:18',
'created' => '2025-02-26 17:09:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 21 => array(
'id' => '4926',
'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
'authors' => 'Cobb L. et all.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (>3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
'date' => '2024-03-22',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
'doi' => '10.1371/journal.pone.0300865',
'modified' => '2024-03-25 11:15:06',
'created' => '2024-03-25 11:15:06',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 22 => array(
'id' => '5059',
'name' => 'EP300/CREBBP acetyltransferase inhibition limits steroid receptor and FOXA1 signaling in prostate cancer cells',
'authors' => 'Jasmin Huttunen et al.',
'description' => '<p><span>The androgen receptor (AR) is a primary target for treating prostate cancer (PCa), forming the bedrock of its clinical management. Despite their efficacy, resistance often hampers AR-targeted therapies, necessitating new strategies against therapy-resistant PCa. These resistances involve various mechanisms, including AR splice variant overexpression and altered activities of transcription factors like the glucocorticoid receptor (GR) and FOXA1. These factors rely on common coregulators, such as EP300/CREBBP, suggesting a rationale for coregulator-targeted therapies. Our study explores EP300/CREBBP acetyltransferase inhibition’s impact on steroid receptor and FOXA1 signaling in PCa cells using genome-wide techniques. Results reveal that EP300/CREBBP inhibition significantly disrupts the AR-regulated transcriptome and receptor chromatin binding by reducing the AR-gene expression. Similarly, GR’s regulated transcriptome and receptor binding were hindered, not linked to reduced GR expression but to diminished FOXA1 chromatin binding, restricting GR signaling. Overall, our findings highlight how EP300/CREBBP inhibition distinctively curtails oncogenic transcription factors’ signaling, suggesting the potential of coregulatory-targeted therapies in PCa.</span></p>',
'date' => '2024-03-13',
'pmid' => 'https://link.springer.com/article/10.1007/s00018-024-05209-z',
'doi' => 'https://doi.org/10.1007/s00018-024-05209-z',
'modified' => '2025-02-26 17:12:18',
'created' => '2025-02-26 17:12:18',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 23 => array(
'id' => '4923',
'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
'authors' => 'Gerbaldo F. et al.',
'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs – in our case NFkB – at the protein level.</span></p>',
'date' => '2024-03-10',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
'modified' => '2024-03-13 17:04:33',
'created' => '2024-03-13 17:04:33',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 24 => array(
'id' => '4918',
'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
'authors' => 'Katsuda T.',
'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
'date' => '2024-02-26',
'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
'modified' => '2024-02-29 11:59:10',
'created' => '2024-02-29 11:59:10',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 25 => array(
'id' => '5003',
'name' => 'Improved metagenome assemblies through selective enrichment of bacterial genomic DNA from eukaryotic host genomic DNA using ATAC-seq',
'authors' => 'Lindsey J Cantin et al.',
'description' => '<p><span>Genomics can be used to study the complex relationships between hosts and their microbiota. Many bacteria cannot be cultured in the laboratory, making it difficult to obtain adequate amounts of bacterial DNA and to limit host DNA contamination for the construction of metagenome-assembled genomes (MAGs). For example, </span><em>Wolbachia</em><span><span> </span>is a genus of exclusively obligate intracellular bacteria that live in a wide range of arthropods and some nematodes. While<span> </span></span><em>Wolbachia</em><span><span> </span>endosymbionts are frequently described as facultative reproductive parasites in arthropods, the bacteria are obligate mutualistic endosymbionts of filarial worms. Here, we achieve 50-fold enrichment of bacterial sequences using ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) with<span> </span></span><em>Brugia malayi</em><span><span> </span>nematodes, containing<span> </span></span><em>Wolbachia</em><span><span> </span>(</span><em>w</em><span>Bm). ATAC-seq uses the Tn5 transposase to cut and attach Illumina sequencing adapters to accessible DNA lacking histones, typically thought to be open chromatin. Bacterial and mitochondrial DNA in the lysates are also cut preferentially since they lack histones, leading to the enrichment of these sequences. The benefits of this include minimal tissue input (<1 mg of tissue), a quick protocol (<4 h), low sequencing costs, less bias, correct assembly of lateral gene transfers and no prior sequence knowledge required. We assembled the<span> </span></span><em>w</em><span>Bm genome with as few as 1 million Illumina short paired-end reads with >97% coverage of the published genome, compared to only 12% coverage with the standard gDNA libraries. We found significant bacterial sequence enrichment that facilitated genome assembly in previously published ATAC-seq data sets from human cells infected with<span> </span></span><em>Mycobacterium tuberculosis</em><span><span> </span>and<span> </span></span><em>C. elegans</em><span><span> </span>contaminated with their food source, the OP50 strain of<span> </span></span><em>E. coli</em><span>. These results demonstrate the feasibility and benefits of using ATAC-seq to easily obtain bacterial genomes to aid in symbiosis, infectious disease, and microbiome research.</span></p>',
'date' => '2024-02-15',
'pmid' => 'https://pmc.ncbi.nlm.nih.gov/articles/PMC10902005/',
'doi' => '10.3389/fmicb.2024.1352378',
'modified' => '2024-11-29 11:10:24',
'created' => '2024-11-29 11:10:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 26 => array(
'id' => '4889',
'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
'authors' => 'Klein D.C. et al. ',
'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
'date' => '2023-12-21',
'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
'doi' => '10.1158/2767-9764.CRC-23-0382',
'modified' => '2024-01-02 11:07:14',
'created' => '2024-01-02 11:07:14',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 27 => array(
'id' => '5054',
'name' => 'Revisiting chromatin packaging in mouse sperm',
'authors' => 'Qiangzong Yin et al. ',
'description' => '',
'date' => '2023-12-21',
'pmid' => 'https://genome.cshlp.org/content/33/12/2079.short',
'doi' => 'https://www.genome.org/cgi/doi/10.1101/gr.277845.123',
'modified' => '2025-02-26 17:03:24',
'created' => '2025-02-26 17:03:24',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 28 => array(
'id' => '5063',
'name' => 'A fast and inexpensive plate-based NGS library preparation method for insect genomics',
'authors' => 'Lauren Cobb et al.',
'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we investigate a fast and economical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs stored under different conditions. Using a standardised input of 6ng DNA, library preparation costs were significantly reduced through the 6-fold dilution of a commercially available tagmentation enzyme. Costs were further suppressed by direct post-amplification pooling, skipping quality assessment of individual libraries. We find that reduced DNA yields associated with ethanol-based storage do not impede overall sequencing success. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By lowering data generation costs, broadening the scope of whole genome studies to include low yield DNA extracts and increasing throughput, we expect this protocol to be of significant value for a range of applications in the field of insect genomics.</span></p>',
'date' => '2023-11-25',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.11.24.568434v1.abstract',
'doi' => 'https://doi.org/10.1101/2023.11.24.568434',
'modified' => '2025-02-26 17:24:46',
'created' => '2025-02-26 17:24:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 29 => array(
'id' => '5060',
'name' => 'Therapeutic targeting of EP300/CBP by bromodomain inhibition in hematologic malignancies',
'authors' => 'Luciano Nicosia et al. ',
'description' => '<p><span>CCS1477 (inobrodib) is a potent, selective EP300/CBP bromodomain inhibitor which induces cell-cycle arrest and differentiation in hematologic malignancy model systems. In myeloid leukemia cells, it promotes rapid eviction of EP300/CBP from an enhancer subset marked by strong MYB occupancy and high H3K27 acetylation, with downregulation of the subordinate oncogenic network and redistribution to sites close to differentiation genes. In myeloma cells, CCS1477 induces eviction of EP300/CBP from </span><i>FGFR3</i><span>, the target of the common (4; 14) translocation, with redistribution away from IRF4-occupied sites to TCF3/E2A-occupied sites. In a subset of patients with relapsed or refractory disease, CCS1477 monotherapy induces differentiation responses in AML and objective responses in heavily pre-treated multiple myeloma.<span> </span></span><i>In vivo</i><span><span> </span>preclinical combination studies reveal synergistic responses to treatment with standard-of-care agents. Thus, CCS1477 exhibits encouraging preclinical and early-phase clinical activity by disrupting recruitment of EP300/CBP to enhancer networks occupied by critical transcription factors.</span></p>',
'date' => '2023-11-22',
'pmid' => 'https://www.cell.com/cancer-cell/fulltext/S1535-6108(23)00366-5',
'doi' => '10.1016/j.ccell.2023.11.001',
'modified' => '2025-02-26 17:15:25',
'created' => '2025-02-26 17:15:25',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 30 => array(
'id' => '4878',
'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
'authors' => 'Menon D.U. et al.',
'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
'date' => '2023-09-28',
'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
'modified' => '2023-11-10 14:53:09',
'created' => '2023-11-10 14:53:09',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 31 => array(
'id' => '4825',
'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
'authors' => 'Miyazaki S. et al.',
'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
'date' => '2023-07-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
'doi' => '10.1038/s42003-023-05148-8',
'modified' => '2023-08-01 13:30:58',
'created' => '2023-08-01 15:59:38',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 32 => array(
'id' => '4817',
'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
'authors' => 'Yamazaki M. et al.',
'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
'date' => '2023-04-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
'doi' => '10.15252/embj.2022112614',
'modified' => '2023-06-15 10:06:12',
'created' => '2023-06-13 21:11:31',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 33 => array(
'id' => '4757',
'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
'authors' => 'Cittaro D. et al.',
'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10× Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et al. (2022) and de Pretis and Cittaro (2022)..</p>',
'date' => '2023-03-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
'doi' => '10.1016/j.xpro.2023.102176',
'modified' => '2023-04-17 09:04:55',
'created' => '2023-04-14 13:41:22',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 34 => array(
'id' => '4742',
'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
'authors' => 'Zou Han et al.',
'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled 1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue 2 (EZH2) and nuclear factor I X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
'date' => '2023-02-01',
'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
'doi' => '10.1038/s41556-023-01093-0',
'modified' => '2023-03-14 09:41:24',
'created' => '2023-03-02 17:27:08',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 35 => array(
'id' => '4568',
'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
'authors' => 'Katsuda T. et al.',
'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expression that can attract transcription factors from the starting cell’s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
'date' => '2023-01-01',
'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
'doi' => '10.1101/2023.02.14.528556',
'modified' => '2023-04-11 10:26:02',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
),
(int) 36 => array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
[maximum depth reached]
)
)
),
'Testimonial' => array(
(int) 0 => array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
[maximum depth reached]
)
)
),
'Area' => array(),
'SafetySheet' => array()
)
$meta_canonical = 'https://dev.diagenode.com/en/p/tagmentase-loaded-200ul'
$fromEmail = 'dev.diagenode.com'
$country = 'US'
$countries_allowed = array(
(int) 0 => 'CA',
(int) 1 => 'US',
(int) 2 => 'IE',
(int) 3 => 'GB',
(int) 4 => 'DK',
(int) 5 => 'NO',
(int) 6 => 'SE',
(int) 7 => 'FI',
(int) 8 => 'NL',
(int) 9 => 'BE',
(int) 10 => 'LU',
(int) 11 => 'FR',
(int) 12 => 'DE',
(int) 13 => 'CH',
(int) 14 => 'AT',
(int) 15 => 'ES',
(int) 16 => 'IT',
(int) 17 => 'PT'
)
$outsource = false
$other_formats = array(
(int) 0 => array(
'id' => '3246',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '25 U / 200 µl',
'catalog_number' => 'C01070013-200',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '1920',
'price_USD' => '1920',
'price_GBP' => '1645',
'price_JPY' => '345600',
'price_CNY' => '',
'price_AUD' => '4800',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-200ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:44:59',
'created' => '2025-05-27 23:40:37'
),
(int) 1 => array(
'id' => '3243',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '1,25 U / 10 µl ',
'catalog_number' => 'C01070013-10',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '120',
'price_USD' => '120',
'price_GBP' => '105',
'price_JPY' => '21600',
'price_CNY' => '',
'price_AUD' => '300',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-10ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 10 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 17:45:47',
'created' => '2025-05-22 15:14:17',
'ProductsGroup' => array(
'id' => '431',
'product_id' => '3243',
'group_id' => '368'
)
),
(int) 2 => array(
'id' => '3245',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '10 U / 80 µl',
'catalog_number' => 'C01070013-80',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '835',
'price_USD' => '835',
'price_GBP' => '715',
'price_JPY' => '150300',
'price_CNY' => '',
'price_AUD' => '2088',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-80ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 80 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:46:35',
'created' => '2025-05-27 23:38:24',
'ProductsGroup' => array(
'id' => '433',
'product_id' => '3245',
'group_id' => '368'
)
),
(int) 3 => array(
'id' => '3247',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '50 U / 400 µl',
'catalog_number' => 'C01070013-400',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '3200',
'price_USD' => '3200',
'price_GBP' => '2740',
'price_JPY' => '576000',
'price_CNY' => '',
'price_AUD' => '8000',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-400ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 400 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:07',
'created' => '2025-05-27 23:44:41',
'ProductsGroup' => array(
'id' => '435',
'product_id' => '3247',
'group_id' => '368'
)
),
(int) 4 => array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
)
$pro = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
'id' => '82',
'name' => 'Tagmentase',
'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
'featured' => true,
'slug' => 'testimonial-tagmentase',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-02-08 09:40:13',
'created' => '2023-02-08 09:37:00',
'ProductsTestimonial' => array(
'id' => '216',
'product_id' => '3244',
'testimonial_id' => '82'
)
)
$related_products = '<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011034</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
'C01011034',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011036</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3185" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3185" id="CartAdd/3185Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3185" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set II</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set II',
'C01011036',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set2" data-reveal-id="cartModal-3185" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set II</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011037</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3206" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3206" id="CartAdd/3206Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3206" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for tagmented libraries - Set III</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('24 UDI for tagmented libraries - Set III',
'C01011037',
'190',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set3" data-reveal-id="cartModal-3206" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">24 UDI for tagmented libraries - Set III</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/chipmentation-kit-for-histones"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01011009</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3184" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3184" id="CartAdd/3184Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3184" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ChIPmentation Kit for Histones</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ChIPmentation Kit for Histones',
'C01011009',
'2235',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="chipmentation-kit-for-histones" data-reveal-id="cartModal-3184" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ChIPmentation Kit for Histones</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01080006</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
'C01080006',
'2050',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">ATAC-seq package for tissue</h6>
</div>
</div>
</li>
<li>
<div class="row">
<div class="small-12 columns">
<a href="/en/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a> </div>
<div class="small-12 columns">
<div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
<span class="success label" style="">C01019043</span>
</div>
<div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
<!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
<!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/en/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p>Add <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> to my shopping cart.</p>
<div class="row">
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">Checkout</button> </div>
<div class="small-6 medium-6 large-6 columns">
<button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
'C01019043',
'105',
$('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">Keep shopping</button> </div>
</div>
</div>
</div>
</form><a class="close-reveal-modal" aria-label="Close">×</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
</div>
</div>
<div class="small-12 columns" >
<h6 style="height:60px">Tagmentation Buffer (2x)</h6>
</div>
</div>
</li>
'
$related = array(
'id' => '3162',
'antibody_id' => null,
'name' => 'Tagmentation Buffer (2x)',
'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p></p>',
'label1' => 'Examples of use',
'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 µl</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;"> 5 µl</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>* The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction. </em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37°C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 µl of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label2' => '',
'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'label3' => '',
'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
'format' => '300 µl ',
'catalog_number' => 'C01019043',
'old_catalog_number' => '',
'sf_code' => 'C01019043-29421',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '90',
'price_USD' => '105',
'price_GBP' => '105',
'price_JPY' => '16200',
'price_CNY' => '',
'price_AUD' => '262',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => false,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => true,
'last_datasheet_update' => '',
'slug' => 'tagmentation-buffer-2x',
'meta_title' => 'Tagmentation Buffer 2x',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2023-06-20 18:19:03',
'created' => '2020-12-08 16:00:14',
'ProductsRelated' => array(
'id' => '5032',
'product_id' => '3244',
'related_id' => '3162'
),
'Image' => array(
(int) 0 => array(
'id' => '1776',
'name' => 'product/kits/kit-icon.png',
'alt' => 'Kit icon',
'modified' => '2019-04-09 12:06:37',
'created' => '2018-03-15 15:51:02',
'ProductsImage' => array(
[maximum depth reached]
)
)
)
)
$rrbs_service = array(
(int) 0 => (int) 1894,
(int) 1 => (int) 1895
)
$chipseq_service = array(
(int) 0 => (int) 2683,
(int) 1 => (int) 1835,
(int) 2 => (int) 1836,
(int) 3 => (int) 2684,
(int) 4 => (int) 1838,
(int) 5 => (int) 1839,
(int) 6 => (int) 1856
)
$labelize = object(Closure) {
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
'id' => '3248',
'antibody_id' => null,
'name' => 'Tagmentase (Tn5 transposase) – loaded',
'description' => '<p><b>Hologic Diagenode Tagmentase – Loaded</b> is a highly efficient, hyperactive Tn5 transposase pre-loaded with Illumina-compatible sequencing adapters. By combining DNA cleavage and adapter insertion into a single step, it simplifies and optimizes workflows for Next-Generation Sequencing (NGS) applications. This product is perfectly suited for technologies such as <b>ATAC-seq</b>, <b>ChIPmentation</b>, <b>genomic DNA </b><b>tagmentation</b> and other NGS methods, offering reliable performance and streamlined efficiency.</p>
<p><b>New! </b><b>Standardized Unit Formulation</b><br /> To ensure consistent performance across different batches, we have introduced and standardized Unit (U) formulation. This guarantees that you experience the same high-quality results with every purchase.</p>
<h3 style="font-weight: bold; color: #2b2967; text-align: center;">Tagmentase lot-to-lot consistency</h3>
<div class="carrousel" style="background-position: center; width: 100%;">
<div class="slick">
<div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig1-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-12 small-12 medium-12 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 1. Fingerprint plot demonstrates consistent efficiency of the Tagmentase (Tn5 transposase) - loaded across the samples and lots.</strong><br />This figure shows the comparison of two standardized lots of Tagmentase (Lot A and Lot B). The fingerprint plot shows the efficiency of the Tagmentase enzyme, illustrating the cumulative distribution of read coverage across the genome. The x-axis represents the fraction of the genome, while the y-axis indicates the cumulative fraction of reads. The plot highlights the enrichment of reads in accessible chromatin regions, with a steep slope indicating high accessibility and a flatter slope representing less accessible regions. The data were normalized to account for sequencing depth and biases. <strong>Lot A and B show equivalent enrichment</strong>.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig2-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns">
<p><em><small><strong>Figure 2. Volcano Plot Confirms Consistent Chromatin Accessibility Between Tagmentase (Tn5 transposase) – loaded Lots A and B.</strong><br />The Volcano plot shows the differentially accessible sites in Lot-A compared to Lot-B, with the log2 fold change on the x-axis and the -log10() of the FDR (q-value) on the y-axis. Regions were considered as significantly differentially accessible when the log2 fold change > 2 and an adjusted p-value (q-value or FDR) < 0,01.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig3-standardizedTagmentase.jpg" max-height="250px" caption="false" width="400" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 3. Heatmap around TSS demonstrates equivalent enrichment of the lot A and B of the Tagmentase (Tn5 transposase) - loaded.</strong><br />The heatmap shows the read enrichment 3 kb up and downstream of the Transcription Start Site (TSS) of each gene present in the hg38 genome. A sharp peak reflects the openness of the TSS regions targeted by the Tagmentase enzyme.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig4-standardizedTagmentase.jpg" width="400" caption="false" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 4. Fragment length distribution: Lots A and B of the Tagmentase (Tn5 transposase) – loaded exhibit identical and expected fragment size profiles, confirming lot-to-lot consistency.</strong><br />The figure shows the fragment size distribution profiles obtained from two standardized lots of Tagmentase (Lot A and Lot B). Both Tagmentase Lot A and Lot B exhibit identical fragment size distribution profiles, with matching peak intensity and shape. This consistency reflects high reproducibility between lots. In ATAC-seq experiments, a high-quality library is characterized by a sharp peak below 100 bp (representing nucleosome-free, open chromatin), a distinct peak around 200 bp (mono-nucleosomes), and additional peaks at ~400 bp and higher (multi-nucleosomes). The observed profiles from both lots align with this expected pattern, confirming the integrity and quality of the libraries.</small></em></p>
</div>
</div>
<div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentation/fig5-standardizedTagmentase-cropped.jpg" /></center></div>
<div class="large-10 small-12 medium-10 large-centered medium-centered small-centered columns"><br />
<p><em><small><strong>Figure 5: IGV snapshots demonstrated identical peaks identified with two lots of standardized Tagmentase (Tn5 transposase) - loaded.</strong><br />The figure shows results obtained from two standardized lots of Tagmentase (lot A and lot B). Genome browser images depict the two most intense consensus peaks across all samples, with counts per million -normalized data adjusted to the same scale for comparison.</small></em></p>
</div>
</div>
</div>
<p><b>Additional Items You May Need:</b></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes tagmented libraries</a></li>
</ul>
<p>Looking for an unloaded Tagmentase? Check out<span> </span><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase (Tn5 transposase) – unloaded</a></p>
<p>Learn more about <a href="https://www.diagenode.com/en/pages/tagmentase">Tagmentation</a>.</p>
</div>',
'label1' => 'Product information',
'info1' => '<p>Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<p><br />• <strong>Mosaic end_reverse:</strong> 5’ [PHO]CTGTCTCTTATACACATCT 3’ <br />• <strong>Mosaic end_Adapter A:</strong> 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’ <br />• <strong>Mosaic end_Adapter B:</strong> 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’</p>
<p>Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.<br />The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:<br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagemented libraries - Set I</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /> • <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries - Set III</a></p>
<p><br /><strong>Unit (U) Definition</strong><br />One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.</p>
<p><br /><strong>Storage Conditions</strong><br />• Store at -20°C.<br />• Guaranteed stable for six months from the date of receipt when stored properly.</p>
<p><br /><strong>Storage Buffer</strong><br />• Supplied in a solution containing 50% (v/v) glycerol.</p>
<p><strong>Properties & Usage</strong><br />• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.<br />• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.<br />• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.</p>
<p><br /><strong>Recommended Buffers</strong><br />• <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> - Hologic Diagenode, Cat. No. C01070011<br />• <a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x-100">Tagmentation Buffer (2x)</a> - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use</p>
<p><br /><strong>Applications</strong><br />Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:</p>
<p><br />• <strong>Genomic DNA tagmentation:</strong> 0.25–1 U per 25–100 ng of DNA<br />• <strong>ATAC-seq:</strong> 0.3 U per 50,000 cells<br />• <strong>ChIPmentation:</strong> 0.125 U per reaction</p>
<p><br />Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.</p>
<p><br /><strong>Recommended Protocols</strong><br />For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:<br />• <a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq Kit</a> - Hologic Diagenode, Cat. No. C01080002<br />• <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011009<br />• <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">μChIPmentation Kit for Histones</a> - Hologic Diagenode, Cat. No. C01011011<br />• <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> - Hologic Diagenode, Cat. No. C01011030</p>
<p><br /><strong>Quality Control</strong><br />Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:<br />• Protein Purity and Integrity by SDS-PAGE<br />• Nuclease Activity to confirm the absence of nonspecific DNase activity<br />• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation<br />• Functional by ATAC-seq, including checks for contaminating DNA from <em>E. coli</em></p>
<p><br /><strong>Precautions</strong><br />This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.</p>',
'label2' => 'Genomic DNA tagmentation protocol',
'info2' => '<p style="font-weight: bold; color: #2b2967; font-size: 1.2em; text-align: center;">Tagmentase (Tn5 transposase) is fully compatible with genomic DNA tagmentation. We recommand using our validated protocol for optimal results. Fill out the form to access the protocol:<br /><br /> <iframe width="300" height="500px" style="border: 0; background-color: #f1f3f5; width: 100%!important;" src="https://go.diagenode.com/l/928883/2025-05-28/5m6m2" type="text/html" frameborder="0" allowtransparency="true"></iframe></p>',
'label3' => '',
'info3' => '',
'format' => '100 U / 800 µl',
'catalog_number' => 'C01070013-800',
'old_catalog_number' => '',
'sf_code' => '',
'type' => 'FRE',
'search_order' => '',
'price_EUR' => '/',
'price_USD' => '/',
'price_GBP' => '/',
'price_JPY' => '/',
'price_CNY' => '/',
'price_AUD' => '/',
'country' => 'ALL',
'except_countries' => 'None',
'quote' => true,
'in_stock' => false,
'featured' => false,
'no_promo' => false,
'online' => true,
'master' => false,
'last_datasheet_update' => '',
'slug' => 'tagmentase-loaded-800ul',
'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 800 | Hologic Diagenode',
'meta_keywords' => '',
'meta_description' => 'Hologic Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
'modified' => '2025-06-03 10:47:39',
'created' => '2025-05-27 23:47:08',
'ProductsGroup' => array(
'id' => '436',
'product_id' => '3248',
'group_id' => '368'
)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
'id' => '1191',
'name' => 'Datasheet Tagmentase (Tn5 transposase) - loaded',
'description' => '',
'image_id' => null,
'type' => 'Datasheet',
'url' => 'files/products/kits/Datasheet_TagmentaseTn5_Loaded.pdf',
'slug' => 'datasheet-tagmentase-loaded',
'meta_keywords' => '',
'meta_description' => '',
'modified' => '2025-05-28 18:33:38',
'created' => '2025-05-28 18:33:38',
'ProductsDocument' => array(
'id' => '3322',
'product_id' => '3244',
'document_id' => '1191'
)
)
$publication = array(
'id' => '4660',
'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
'authors' => 'Zolotarev Nikolay et al.',
'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
'date' => '2022-11-01',
'pmid' => 'https://doi.org/10.1073%2Fpnas',
'doi' => '10.1073/pnas.2210595119',
'modified' => '2023-03-07 09:07:41',
'created' => '2023-02-21 09:59:46',
'ProductsPublication' => array(
'id' => '8387',
'product_id' => '3244',
'publication_id' => '4660'
)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'CustomErrorHandler::handleError() - APP/Lib/CustomErrorHandler.php, line 9
include - APP/View/Products/view.ctp, line 747
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1055
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118
×